This work is licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly.
Background
Retinoblastoma is the most common intraocular tumor in childhood and mutation in the RB1 gene will trigger the tumorigenesis. So far, a wide range of the mutations along the length of RB1 gene have been reported. However, some could not be detected by common detection methods. In such condition, linkage analysis using microsatellite markers is suggested to trace unknown RB1 mutations in the affected family. The aim of the present study was to evaluate the heterozygosity rates and genotyping of three microsatellite markers near or inside of the RB1 gene.
Methods
Totally, 120 unrelated healthy people from Fardis, Karaj, Iran were recruited and from each participant genomic DNA was extracted from 5 ml of peripheral blood. Three microsatellite markers D13S153, D13S156 and D13S128 located within or adjacent to the RB1 gene were selected for linkage analysis. The reliability of microsatellite markers and linkage analysis were investigated in 10 members of 2 families with familial retinoblastoma.
Results
Our results showed that heterozygosity rates for the three markers D13S153, D13S156 and D13S128 were 74, 70 and 78%, respectively. On the other hand, 2 and 36 out of 120 people were homozygote and heterozygous for all loci, respectively.
Conclusion
Given the heterozygosity rates, it may be concluded that all microsatellite markers D13S153, D13S156 and D13S128 are informative and have a high rate of heterozygosity and sensitivity. Therefore, tracing the unknown RB1 mutated alleles using linkage analysis in Iranian family with familial retinoblastoma could be recommended by means of these three microsatellite markers.
Retinoblastoma is the most common intraocular malignancy in children. It arises after two distinct inactivating mutational events in both alleles of the RB1 gene in an immature retinal cell. Roughly half of the patients with retinoblastoma inherit one mutated RB1 allele. Among them, many will be affected by bilateral retinoblastoma in childhood. Additionally, near one third of bilateral patients (15-20% totally) have a positive familial history for the retinoblastoma or retinoma. Detection of RB1 mutations in affected families will enhance the quality of clinical management of the probands and relatives at risk (1, 2).
Genetic diagnosis has a great impact on management of families with retinoblastoma (3). In many developed countries, mutation detection as a routine part of clinical approaches is suggested to all affected families with retinoblastoma. Once the mutation was detected, to avoid transmission of the mutation, Pre-implantation Genetic Diagnosis (PGD) and Prenatal genetic Diagnosis (PND) as well as screening of carriers among proband's sibs could be performed (3). Because all sibs of the proband are at risk of developing retinoblastoma, they periodically undergo a series of clinical examinations including Examination Under Anesthetic (EUA) to diagnose and treat tumors as early as possible. With carrier testing in the families it is no longer needed to EUA and fundoscopic examinations of the healthy sibs. In such a way, if the proband's RB1 gene status is determined by genetic testing, only those relatives with the mutation require clinical surveillance, whereas those proven to be non carriers require no further examinations (1, 2, 4–7).
In the past two decades, wide spectrums of different mutations in the promoter, exonic and intronic regions of the RB1 gene, have been reported which are actually scattered along the RB1 gene. Unfortunately, there is no real hot spot in the RB1 gene and as a result many of these mutations are unique to a person and have not been seen in other patients. Due to low frequency of each unique mutations and distribution of other mutations all over the RB1 gene, identification of genetic causes of retinoblastoma is difficult and time consuming (8–22).
In some patients, in spite of family history of retinoblastoma no mutation is detected, so performing PGD and PND for patients with unknown mutation is impossible. To overcome this problem, it is usually suggested to use linkage analysis and define the likelihood of transmission of mutant allele to the pro-band with a high accuracy. For linkage analysis in affected families, easily detectable linked markers to the RB1 gene with high rates of heterozygosity must be available and evaluated allele's frequency for each of the relevant markers in the population (23–28). However, to the best of our knowledge, allele frequencies for the microsatellite markers linked to the RB1 gene have not been evaluated and characterized among Iranian people. Therefore, the aim of the present study was to define the polymorphism and genotyping of the three microsatellite markers within or adjacent to the RB1 gene in Iranian population.
Materials and MethodsSubjects
A total of 120 unrelated healthy people from Fardis, Karaj, Iran were recruited for this study during 2010-2011. All participants were ethnically Iranian with no family history of retinoblastoma. From each person 5 ml of peripheral blood in EDTA containing tubes were collected. Genomic DNA from peripheral blood was extracted by a standard salting out method as described elsewhere (29). Informed consent was obtained from each participant. The study protocol was approved by the Ethics Committee of the Avicenna Research Institute. The reliability of microsatellite markers and linkage analysis were investigated in 10 members of 2 families with familial retinoblastoma.
Polymerase chain reaction
Three microsatellite markers D13S153, D13S156 and D13S128 located within or adjacent to the RB1 gene on chromosome 13q were selected for linkage analysis. Primer sequences are shown in Table 1. The PCR reactions carried out in final volume of 25 µl containing: 2.5 µl of 10× PCR buffer (Roche, Germany), 1.5 mM MgCl2 (Roche, Germany), 0.4 mM of each dNTP (Fermentas, Germany), 10 pmol of each primer, 50 ng template DNA, 1 U Taq DNA polymerase (Roche, Germany) and sterile distilled water up to 25 µl. PCR was performed with an initial denaturation step at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, ended by a final extension at 72°C for 10 min. Then PCR products were separated on 12% polyacrylamide gels and visualized by Silver Nitrate staining.
The primer sequences used for amplification of microsatellites markers
Markers
Direction
Primer sequence (5' > 3')
D13S153
Forward
ATCAGGGCTATGTATAACC
Reverse
AGCAGTGAAGGTCTAAGC
D13S156
Forward
ATTAGCCCAGGTATGGTGAC
Reverse
GCTGTGGTATGAGTTACTTAAACAC
D13S128
Forward
TTCACCGAAGTGGAAGAGAGAT
Reverse
Reverse GGACACAACTGACTTCATAATGAAT
Genotyping
After electrophoresis and analyzing the bands pattern for each sample, those which had the fragments with a higher likelihood of homozygosity were chosen and amplification by PCR was repeated for them. Then, the PCR products were separated on the 12% polyacrylamide gels and followed by Ethidium Bromide staining. In the next step to avoid contamination by the shadow and stutter bands, the main band in each lane were cut and transferred to 1.5 ml microtube. The pieces of gel containing the band were crushed and homogenized by pestle and then soaked in 100-500 µl PBS buffer (depending on the amount of the cut gel). Then, the dissolved DNA fragments were precipitated using sodium acetate and ethanol (30, 31). The purified DNA was sequenced using Big Dye terminator chemistry and analyzed by Chromas software.
Results
Three microsatellite markers D13S153, D13S156 and D13S128 located within or adjacent to the RB1 gene on chromosome 13q were checked using PCR in the 120 selected people. Analysis of microsatellites revealed that heterozygosity rates for the three markers D13S153, D13S156 and D13S128 were 74, 70 and 78%, respectively. Our results showed that 2 and 36 people were homozygote and heterozygote for all three loci, respectively. Three examples of PCR results for the microsatellites markers are shown in the Figures 1 and 2.
Band pattern of D13S153 marker on 12% polyacrilamide gel. The first lane in the right side is marker VIII (Roche)
Band pattern of D13S128 marker on 12% polyacrilamide gel. The first lane in the left side is marker VIII (Roche) and the first lane in the left side is 100 bp marker (Fermentase)
In order to define the number and the type of the repeats in each locus, the largest and the smallest bands as well as some bands in the middle range were extracted from the gel and sequenced. The numbers of alleles for each marker are summarized in Table 2. As clearly depicted in Figures 1 and 2, in the top of each band, stutter and shadow bands are located. These DNA fragments are produced during PCR by slipped strand mispairing mechanism and also were seen in the results of other studies (30, 31).
The results of analyzing the three microsatellites markers in normal people
Markers
Dinucleotide repeats
Heterozygosity rates
Number of alleles
Number of repeats
D13S153
CA
74%
15
15-29
D13S156
CA
70%
11
16-26
D13S128
GT
78%
13
25-37
Linkage analysis in 10 members of 2 families with familial retinoblastoma confirmed the reliability of microsatellite markers in tracing the responsible allele. The pedigree analysis for an engaged family clearly showed that these markers are linked to the mutant allele (Figure 3).
Linkage analysis in a family with retinoblastoma (Patient no. 200 is proband). The arrows show the markers which are linked to the mutant allele. The two microsatellite markers, D13S128 and D13S153 were informative, while D13S156 could not be used for linkage analysis in this family. The first lane of each gel is DNA size marker VIII (Roche)
Discussion
Over the last three decades, many of molecular techniques for detection of mutations have been developed. Therefore, potentially molecular causes of genetic diseases could be clearly detected. However, some of mutations in families affected by various genetic diseases such as retinoblastoma could not be detected by common approaches. In the absence of complement and alternative methods we are unable to assist families with familial retinoblastoma and unknown mutations. To overcome this problem, linkage analysis using polymorphic markers has been suggested as an alternative procedure (32–36). Linked markers are genetic polymorphisms which are easily detected. So far, many of these markers are identified including SNP (Single Nucleotide Polymorphism), RFLP (Restriction Fragment Length Polymorphism), VNTR (Variable Number of Tandem Repeats) and microsatellite markers. According to the facts, in the present survey three microsatellite markers D13S156, D13S153 and D13S128 were used to trace the unknown RB1 mutation in familial retinoblastoma.
The marker D13S153 (Rbi2) is inside the second intron of the RB1 gene. This marker has been investigated in many studies and its heterozygosity rate in many populations has been calculated (24, 26, 28, 37, 38). However, to the best of our knowledge, this is the first study which investigated the heterozygosity rate of D13S153, as well as number of alleles in an Iranian population.
Our results showed that 89 out of 120 people (∼74%) were heterozygote for D13S153 marker. The heterozygosity rates for the two other markers D13S156 and D13S128 were 70 and 78%, respectively. The heterozygosity rates in the other studies are slightly higher than our results, for example in the study by Choy et al the heterozygosity rates for these markers were 64, 89 and 92% respectively (39).
These differences could be explained by various hypotheses. It may be due to genetic composition of the studied populations. High rates of inbreeding will decrease the frequency of heterozygote people. In the present study, samples were collected from a city (Fardis, Karaj, Iran) which has a high immigration rate, so it could be claimed that the studied population is a small sample of Iranian gene pool. However, we expected a higher heterozygosity rates in Iranian population.
According to our results, 2 and 36 of people were homozygous and heterozygous for all the three microsatellite markers, respectively. These results indicated that chosen microsatellite markers are informative and have a high sensitivity for tracing unknown RB1 mutation or responsible allele in affected family.
Linkage analysis despite its advantages in tracing unknown mutation has some limitations. Firstly, for linkage analysis in a family at least two affected individuals, if possible in two generation, must be available. Secondly, if the members of a family are homozygote for all three loci, linkage analysis using these markers is impossible. Thirdly, crossing over in the distance between the markers and the RB1 gene may occur. However, using an intragenic marker along with two markers flanking to RB1 gene will decrease the false results due to crossing over.
The polymorphic markers are also used to analyze Loss of Heterozygosity (LOH) of a specific locus. In retinoblastoma, inactivation of the both alleles of the RB1 gene in immature retinal cells led to tumorigenesis. According to the Knudson two-hit hypothesis, the first mutation is inherited via germline and occurrence of the second one in these cells trigger carcinogenesis. Based on previous studies (1, 8, 10, 21), the most common cause of second allele mutation is LOH. In the gene testing procedure, when the tumor tissue as well as blood sample was available, checking the second mutation in the tumor tissue could be performed through LOH analysis.
Conclusion
Finally, it could be concluded that the three microsatellite markers D13S153, D13S156 and D13S128 have high rates of heterozygosity and could be recommended for linkage analysis in Iranian family with familial retinoblastoma and unknown RB1 mutations.
Acknowledgement
The authors would like to thank all participants for their collaboration and providing blood samples.
ReferencesGallieBCanadian guidelines for retinoblastoma careCan J Ophthalmol2009446639642RichterSVandezandeKChenNZhangKSutherlandJAndersonJSensitive and efficient detection of RB1 gene mutations enhances care for families with retinoblastomaAm J Hum Genet2003722253269NooraniHZKhanHNGallieBLDetskyASCost comparison of molecular versus conventional screening of relatives at risk for retinoblastomaAm J Hum Genet1996592301307MallipatnaACSutherlandJEGallieBLChanHHeonEManagement and outcome of unilateral retinoblastomaJ AAPOS2009136546550GallieBLZhaoJVandezandeKWhiteAChanHSGlobal issues and opportunities for optimized retinoblastoma carePediatr Blood Cancer2007497 Suppl10831090O'DohertyMLaniganBBreathnachFO'MearaAGallieBChanHA retrospective review of visual outcome and complications in the treatment of retinoblastomaIr Med J20059811720DommeringCJvan den HeuvelMRMollACImhofSMMeijers-HeijboerHHennemanLReproductive decision-making: a qualitative study among couples at increased risk of having a child with retinoblastomaClin Genet2010784334341MitterDRushlowDNowakIAnsperger-RescherBGallieBLLohmannDRIdentification of a mutation in exon 27 of the RB1 gene associated with incomplete penetrance retinoblastomaFamilial Cancer2009815558ZielinskiBGratiasSToedtGMendrzykFStangeDERadlwimmerBDetection of chromosomal imbalances in retinoblastoma by matrix-based comparative genomic hybridizationGenes Chromosomes Cancer2005433294301SchulerAWeberSNeuhauserMJurkliesCLehnertTHeimannHAge at diagnosis of isolated unilateral retinoblastoma does not distinguish patients with and without a constitutional RB1 gene mutation but is influenced by a parent-of-origin effectEur J Cancer2005415735740AlbrechtPAnsperger-RescherBSchulerAZeschnigkMGallieBLohmannDRSpectrum of gross deletions and insertions in the RB1 gene in patients with retinoblastoma and association with phenotypic expressionHum Mutat2005265437445LeonePEVegaMEJervisPPestanaAAlonsoJPaz-y-MinoCTwo new mutations and three novel polymorphisms in the RB1 gene in Ecuadorian patientsJ Hum Genet20034812639641ZeschnigkMLohmannDHorsthemkeBA PCR test for the detection of hypermethylated alleles at the retinoblastoma locusJ Med Genet19993610793794DimarasHRushlowDHallidayWDoyleJJBabynPAbellaEMUsing RB1 mutations to assess minimal residual disease in metastatic retinoblastomaTransl Res201015629197KlutzMHorsthemkeBLohmannDRRB1 gene mutations in peripheral blood DNA of patients with isolated unilateral retinoblastomaAm J Hum Genet1999642667668YilmazSHorsthemkeBLohmannDRTwelve novel RB1 gene mutations in patients with hereditary retinoblastoma. Mutations in brief no. 206. OnlineHum Mutat1998126434LohmannDRGerickMBrandtBOelschlagerULorenzBPassargeEConstitutional RB1-gene mutations in patients with isolated unilateral retinoblastomaAm J Hum Genet1997612282294LohmannDRBrandtBHoppingWPassargeEHorsthemkeBThe spectrum of RB1 germ-line mutations in hereditary retinoblastomaAm J Hum Genet1996585940949SzijanILohmannDRParmaDLBrandtBHors-themkeBIdentification of RB1 germline mutations in Argentinean families with sporadic bilateral retinoblastomaJ Med Genet1995326475479LohmannDRBrandtBHoppingWPassargeEHorsthemkeBSpectrum of small length germline mutations in the RB1 geneHum Mol Genet199431221872193IshakSRHanafiHAlagaratnamJVZilfalilBATajudinLSRB pocket domain B mutation frequency in MalaysiaOphthalmic Genet2010313159161AhaniABehnamBKhorshidHRAkbariMTRB1 gene mutations in Iranian patients with retinoblastoma: report of four novel mutationsCancer Genet20112046316322RushlowDPiovesanBZhangKPrigoda-LeeNLMarchongMNClarkRDDetection of mosaic RB1 mutations in families with retinoblastomaHum Mutat2009305842851EmreSSungurAHazarVBilgicSBuyukpamu-kcuMGunalpIA linkage analysis in two families with bilateral retinoblastomaTurk J Pediatr1996384413417HainesJLOzeliusLSt George-HyslopPWexlerNSGusellaJFConneallyPMPartial linkage map of chromosome 13q in the region of the Wilson disease and retinoblastoma genesGenet Epidemiol198856375380AlonsoJGarcia-MiguelPAbelairasJMendiolaMPestanaAA microsatellite fluorescent method for linkage analysis in familial retinoblastoma and deletion detection at the RB1 locus in retinoblastoma and osteosarcomaDiagn Mol Pathol2001101914WilimasJAWilsonMWHaikBGBarnoyaMFuLCastellanosMDevelopment of retinoblastoma programs in Central AmericaPediatr Blood Cancer20095314246OnadimZCowellJKApplication of PCR amplification of DNA from paraffin embedded tissue sections to linkage analysis in familial retinoblastomaJ Med Genet1991285312316LahiriDKByeSNurnbergerJIJrHodesMECrispMA non-organic and non-enzymatic extraction method gives higher yields of genomic DNA from whole-blood samples than do nine other methods testedJ Biochem Biophys Methods1992254193205RabbaniBKhanahmadHBagheriRMahdiehNZeinaliSCharacterization of minor bands of STR amplification reaction of FVIII gene by PCR cloningClin Chim Acta20083941-2114115RabbaniBRezaeianAKhanahmadHBagheriRKamaliEZeinaliSAnalysing two dinucleotide repeats of FVIII gene in Iranian populationHaemophilia2007136740744ChunderNBasuDRoyARoychoudhurySPandaCKPrediction of retinoblastoma and osteosarcoma: linkage analysis of families by using polymorphic markers around RB1 locusJ BUON200384365369LeeCCWuMCWuJYLiTCTsaiFJTsaiCHCarrier detection of Duchenne/Becker muscular dystrophy by using fluorescent linkage analysis in TaiwanActa Paediatr Taiwan20004126974SchwartzLSTarletonJPopovichBSeltzerWKHoffmanEPFluorescent multiplex linkage analysis and carrier detection for Duchenne/Becker muscular dystrophyAm J Hum Genet1992514721729O'LearyCADuffyDBirosICorleySSeddonJMLinkage analysis excludes the involvement of the canine PKD2 homologue in bull terrier polycystic kidney diseaseAnim Genet2006375527528OnoeTKonoshitaTMiyagiKYamadaKMutohHKoniIAn efficient linkage analysis strategy for autosomal dominant polycystic kidney diseaseClin Nephrol2003596406414EmreSSungurABilgicSBuyukpamukcuMGunalpIOzgucMLoss of heterozygosity in the VNTR region of intron 1 of P53 in two retinoblastoma casesPediatr Hematol Oncol1996133253256KatoMVIshizakiKEjimaYKanekoATanookaHSasakiMSLoss of heterozygosity on chromosome 13 and its association with delayed growth of retinoblastomaInt J Cancer1993546922926ChoyKWPangCPYuCBWongHLNgJSFanDSLoss of heterozygosity and mutations are the major mechanisms of RB1 gene inactivation in Chinese with sporadic retinoblastomaHum Mutat2002205408