The E.coli strain DH5α was used for propagation of recombinant plasmids. The P.pastoris strain X-33 (Invitrogen) was used as a host for the protein expression. Recombinant bacteria were cultured in low salt LB broth medium (0.5% (w/v) yeast extract, 1% (w/v) tryptone, 0.5% (w/v) NaCl) supplemented with 25 µg ml ⁻¹ of zeocin (Invitrogen). P.pastoris was cultured on the following media: YPDS plates (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose, 1 M sorbitol, and 1.5% (w/v) bacteriological agar) supplemented with 100 µg ml ⁻¹ of zeocin; Buffered Glycerol-complex Medium (BMGY) medium (1% (w/v) yeast extract, 2% (w/v) peptone, 100 mM potassium phosphate, 1.34% (w/v) Yeast Nitrogen Base (YNB), 4×10⁻⁵% (w/v) biotin, 1% (v/v) glycerol, pH = 6.0); Buffered Methanol-complex Medium (BMMY) medium (1% (w/v) yeast extract, 2% (w/v) peptone, 100 mM potassium phosphate, 1.34% (w/v) YNB, 4×10⁻⁵% (w/v) biotin, 0.5% (v/v) methanol, pH = 6.0) supplemented with 2% Phenyl Methyl Sulphonyl Fluoride (PMSF); Minimal Dextrose (MD) agar (1.34% (w/v) YNB, 4×10⁻⁵% (w/v) biotin, 2% (w/v) dextrose, 2% (w/v) agar); and Minimal Methanol (MM) agar (1.34% (w/v) YNB, 4×10⁻⁵% (w/v) biotin, 0.5% (v/v) methanol, 2% (w/v) agar).

Since the hepatic cells are the main source for AAT expression, total RNA was extracted from human hepatocellular carcinoma (Hep G2) cell line (obtained from the Pasteur Institute of Iran, Tehran). Briefly, about 10⁷ cells were harvested and total RNA was isolated using RNeasy Mini Kit (Qiagen) according to manufacturer's instruction. Primers 1 (5′CTC TCGAGAAAAGAGAGGCTGAAGCTGAAGATCCCCAGGGAGATG 3′) and 2 (5′GC TACTCTAGATAATTTTTGGGTGGGATTCAC 3′) were employed to amplify AAT cDNA excluding its signal peptide (amino acid residues 1-24) from the 100 ng RNA in 20 µl reaction using the One-Step RT-PCR Kit (Qiagen). In designing the primers, restriction sites of XhoI and XbaI were incorporated at the 5′ ends of the PCR products. The cDNA product was cloned into the pPICZαB plasmid (Invitrogen) in a way to introduce the His-tag epitope at the carboxyl terminal of the recombinant AAT.

P.pastoris cells were grown overnight in YPD broth (at 30 ^° C/ 250 rpm) and prepared for transformation according to the manufacturer's recommendations (Invitrogen). The recombinant plasmid was linearized with SacI and electrotransformed into the 80 µl of competent P.pastoris using a Bio-Rad genepulser apparatus (at 1.5 kV, 25 F, 400 Ω and 8 ms). Hundreds of transformed cells were selected by growing on YPD agar plate in presence of 100 µg ml ⁻¹ of zeocin.

Transformation of P.pastoris X-33 cells with linearized DNA results in two phenol-types of host cells in respect with methanol utilization (Mut). Since single crossover recombination at the AOX1 promoter region is favored, most of the transformants have Mut⁺ phenotype in which the AOX1 gene is intact. However, due to the presence of the AOX1 terminator sequences in the plasmid, there is a chance for second recombination at this region which result in replacing of AOX1 gene with desired one hence creating Mut^S phenotype. The latter is weak in metabolizing methanol. The Mut phenotype for the transformed X-33 cells was determined by growing one hundred clones on minimal media with methanol (MM) or dextrose (MD) plates. Chromosomal integration of the plasmid DNA and right orientation of the expression cassette containing the AAT cDNA were characterized by PCR analysis and DNA sequencing. 5' and 3' AOX1 primers (5' GAC TGGTTCCAATTGACAAGC 3' and 5' GC AAATGGCATTCTGACATCC 3'), directed to the AOX1 promoter and the transcription terminator were used for this purpose.

Ten verified transformants were grown at 30 ^° C in 10 ml BMGY medium for 24 hr until reaching an OD₆₀₀ of 10. The cells were harvested and resuspended in 50 ml BMMY medium containing 0.5% (v/v) methanol. After incubating the cells at 30°C/200 rpm for 72 hr methanol was added at 1% (v/v) once a day to maintain induction.

The cells were removed and the supernatant was precipitated by using 100% Trichloroacetic Acid (TCA) solution. After drying, the pellet was resuspended in loading buffer containing β-mercaptoethanol, heated for 10 min, in boiling water and electrophoresed at 12% SDS-PAGE/100 V along with molecular weight marker (Fermentas). Gel was stained with silver nitrate according to Celis and coworkers (16).

Protein samples resolved on SDS-PAGE, were electro-blotted to Polyvinylidene Difluoride (PVDF) membrane (Millipore) in transferring buffer (0.025 M Tris, 0.19 M glycine, and 20% (v/v) methanol) overnight at 20 V/4°C. The membrane was treated with PBS-T-BSA (PBS, 0.1% (v/v) Tween 20, 1% (w/v) BSA) for 2 hr to block binding sites. After washing step, membrane was reacted with 1000-fold diluted goat anti-human alpha-1 antitrypsin polyclonal antibody, conjugated with HRP (Abcam) for 3 hr. To eliminate non specific reactions, a supernatant of non- recombinant X-33 culture treated side by side accordingly as negative control. Subsequently, protein bands reacted positively, were visualized at the presence of 4-chloro1-naphtol substrate in PBS.

The Enzyme-linked Immunosorbent Assay (ELISA) was used for quantitative determination of secreted AAT levels in the medium using human alpha 1-antitrypsin ELISA Quantitation Kit (GenWay Biotech, Inc) according to the manufacturer's recommendations. For all experiments the samples were diluted 200 folds in sample/conjugate diluents (50 mM Tris, 0.14 M NaCl, 1% (w/v) BSA, 0.05% (v/v) Tween 20, pH = 8.0). Different concentrations of commercial human AAT (Sigma) were used to construct standard curve, while supernatant of non-recombinant P.pastoris (X-33 strain) culture was used as a negative control.

For the purification of His-tag fused AAT, the supernatant was applied to a nickel-immobilized chelating sepharose fast flow column (Amersham, Biosciences). For this purpose supernatant first was diluted with equal volume of 2X binding buffer (50 mM NaH₂PO₄, 500 mM NaCl, 10 mM imidazole, pH = 7.4) and loaded on to the column. After passing the wash buffer (50 mM NaH₂PO₄, 500 mM NaCl, a gradient of imidazole from 20 to 40 mM, and 0.05% (v/v) Tween 20, pH = 7.4) through the column, the resin-bounded recombinant AAT was eluted with elution buffer (50 mM NaH₂PO₄, 500 mM NaCl, 250 mM imidazole, and 0.05% (v/v) Tween 20, pH = 7.4).

Elastase activity was measured by Enz-Chek^® Elastase Assay Kit (Molecular Probes, Inc.) according to the manufacturer's recommendations. The EnzChek kit contains DQ™ elastin soluble bovine neck ligament elastin that has been labeled with BODIPY^® FL dye such that the conjugate's fluorescence is quenched. The non-fluorescent substrate can be digested by elastase or other proteases to yield highly fluorescent fragments. The presence of an inhibitor such as AAT blocks the substrate digestion hence subsequent fluorescent emission. The resulting change in fluorescence level was monitored using a standard fluorometer (Hitachi F-3010) with a maximum absorption at 505 nm and a maximum fluorescence emission at 515 nm. Commercial human AAT was used as a positive control and the elution buffer and the supernatant from non-recombinant P.pastoris (X-33 strain) culture as negative controls.

IEF was accomplished on a pharmacia flat-bed electrophoresis apparatus at 4°C using high voltage and carrier pharmalytes (Sigma) over the pH range of 4.5-5.4. The experiment was performed on the 7% polyacrylamide gradient gel. Subsequently, the IEF gel was stained with Coomassie brilliant blue R-250.

Tunicamycin was used to block in vivo glycosylation. To determine differences in glycosylation of the recombinant protein, tunicamycin (Sigma, T7765) was used at final concentration of 2.5 µg/ml in BMMY culture medium. Cell density was checked every day and after 96 hr of induction with methanol, the supernatant was precipitated using 100% TCA solution. The results of SDS–PAGE and western blotting were compared to those of P.pastoris at the same conditions except no tunicamycin.

The cDNA of AAT from HepG2 cell line was cloned in frame with the α-MF secretion signal into the expression vector pPICzαB. The resulting plasmid was named pPICZα-AAT. Transformants were selected on YPDS agar containing zeocin, and the Mut phenol-type was determined by growing them on selective MD and MM media. According to corresponding data, more than 90% of transformants had equal growth features on both media that is a proof for Mut⁺ phenotype. PCR results with AOX1 primers for genomic DNA were consistent with those of screening in selective media and confirmed that the AAT gene had been integrated into the AOX1 locus. The correct orientation and nucleotide sequence of AAT cDNA within the P.pastoris genome verified by sequencing. Mut⁺ clones showed two different bands in agarose gel electrophoresis, the 1.8 kb fragment which was amplified from AAT expression cassette flanked by AOX1 sequences and another 2.2 kb fragment which was amplified from AOX1 gene of P.pastoris. In Mut^S clones only 1.8 kb band was observed, which demonstrates the disruption of AOX1 gene (Figure 1).

Supernatant samples from cultures of few positive clones and one negative clone (non-recombinant X-33) were subjected to SDS-PAGE analysis after precipitation with TCA. The results provided an additional band near 60 kDa only in positive clones (Figure 2, Lanes 1-6). The secreted protein was purified from the supernatant by passing through a nickel column and fractions were screened by SDS-PAGE. The purified protein samples were seen as two or three smeared bands after Coomassie brilliant blue R-250 staining (Figure 3A).

To confirm the identity of recombinant protein, the purified protein was reacted with AAT antibody in a western blot analysis. The recombinant AAT was identified as two distinct bands (Figure 3B, Lane 2) with a molecular weight slightly larger than that of the commercial protein (Figure 3B, Lane 1).

AAT levels in supernatant were determined by quantitative ELISA, using two specific monoclonal antibodies against AAT. Level of protein expression was determined in ten Mut⁺, three Mut^s, and one non-recombinant X-33 clones. According to our data, methanol induction at concentration of 0.5% (v/v) for the first day and 1% (v/v) for the next two days could result in highest level of protein secretion in Mut⁺ phenotype. Average quantities of protein expression were 60 mg/l and 44 mg/l after 72 hr for Mut⁺ and Mut^s clones, respectively (Figure 4).

Data from the activity assays provided an increase in detected fluorescence levels when the elution buffer and/or the supernatant of non-recombinant X-33 culture were screened. However, no changes were seen for commercial AAT and the recombinant AAT (Figure 5).

After staining with Coomassie brilliant dye, recombinant AAT protein was visualized as three bands in IEF acrylamide gel migrating at 5.1 to 5.2 kDa, while plasma derived AAT was detected as five bands from 4.7 to 4.9 kDa (data was not shown).

To investigate whether the protein bands with higher molecular weight were due to different glycosylation, we expressed the AAT in media containing tunicamycin which blocks glycosylation in vivo, and analysed the supernatant by SDS-PAGE and western blotting. In the presence of tunicamycin the AAT band shifted to a position lowers than that of natural and recombinant proteins (Figure 6).