<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" article-type="research-article" xml:lang="en">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">AJMB</journal-id>
			<journal-title>Avicenna Journal of Medical Biotechnology</journal-title>
			<issn pub-type="ppub">2008-2835</issn>
			<issn pub-type="epub">2008-4625</issn>
			<publisher>
				<publisher-name>Avicenna Research Institute</publisher-name>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="publisher-id">AJMB-2-197</article-id>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Original Article</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>High Expression of Methylotrophic Yeast-Derived Recombinant Human Erythropoietin in a pH-Controlled Batch System</article-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author">
					<name>
						<surname>Maleki</surname>
						<given-names>Ahmad</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
					<xref ref-type="aff" rid="AF0003">3</xref>
				</contrib>
				<contrib contrib-type="author" corresp="yes">
					<name>
						<surname>Roohvand</surname>
						<given-names>Farzin</given-names>
					</name>
					<xref ref-type="aff" rid="AF0002">2</xref>
					<xref ref-type="corresp" rid="cor1">&#x002A;</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Tajerzadeh</surname>
						<given-names>Hosnieh</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Khanahmad</surname>
						<given-names>Hossein</given-names>
					</name>
					<xref ref-type="aff" rid="AF0003">3</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Nobari</surname>
						<given-names>Maryam B.</given-names>
					</name>
					<xref ref-type="aff" rid="AF0004">4</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Beiruti</surname>
						<given-names>Ahmad</given-names>
					</name>
					<xref ref-type="aff" rid="AF0003">3</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Najafabadi</surname>
						<given-names>Abdolhossein Rouholamini</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
				</contrib>
			</contrib-group>
			<aff id="AF0001">
				<label>1</label>Faculty of Pharmacy, Tehran University of Medical Science, Tehran, Iran</aff>
			<aff id="AF0002">
				<label>2</label>Hepatitis &#x0026; AIDS Department, Pasteur Institute of Iran, Tehran, Iran</aff>
			<aff id="AF0003">
				<label>3</label>Research and Production Plant, Pasteur Institute of Iran, Karaj, Iran</aff>
			<aff id="AF0004">
				<label>4</label>Open University of Zanjan, Zanjan, Iran</aff>
			<author-notes>
				<corresp id="cor1">
				<label>&#x002A;</label>
				<bold>Corresponding author:</bold> Farzin Roohvand, Ph.D., Hepatitis &#x0026; AIDS Department, Pasteur Institute of Iran, Tehran, Iran. <bold>Tel:</bold> +98 21 66969291. <bold>Fax:</bold> +98 21 66969291. <bold>E-mails:</bold> <email xlink:href="rfarzin@pasteur.ac.ir">rfarzin@pasteur.ac.ir</email>; <email xlink:href="farzin.roohvand@gmail.com">farzin.roohvand@gmail.com</email>
				</corresp>
			</author-notes>
			<pub-date pub-type="ppub">
				<season>October-December</season>
				<year>2010</year>
			</pub-date>
			<volume>2</volume>
			<issue>4</issue>
			<fpage>197</fpage>
			<lpage>206</lpage>
			<history>
				<date date-type="received">
					<day>20</day>
					<month>10</month>
					<year>2010</year>
				</date>
				<date date-type="accepted">
					<day>20</day>
					<month>12</month>
					<year>2010</year>
				</date>
			</history>
			<permissions>
				<copyright-statement>Copyright &#x00A9; 2010 Avicenna Research Institute</copyright-statement>
				<copyright-year>2010</copyright-year>
				<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">
					<p>This work is licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly.</p>
				</license>
			</permissions>
			<abstract>
				<p>To accomplish the worldwide demand for recombinant human erythropoietin (rHuEpo) as a therapeutic, application of cost-efficient expression system of methylotrophic yeast <italic>Pichia pastoris</italic> (<italic>P. pastoris</italic>) rather than mammalian cells is indispensable. Herein, a report on high levels secreted-expression of <italic>Pichia</italic>-derived rHuEpo by batch fermentation in a pH stabilized format is presented. The full length cDNA of rHuEpo was inserted into pPICZ&#x3B1;A vector under control of <italic>AOX</italic>1 promoter, downstream of the secretion-&#x3B1;-factor and electroporated into <italic>P. pastoris</italic> strain X33. The highest expression transformant was selected by screening among the colonies surviving high concentration of Zeocin (1.0 <italic>mg/ml</italic>), followed by comparative small scale expression analysis by ELISA. Stabilization of pH around 6.0 by adding phosphoric acid into the culture media during induction period, improved the yield of expression to 150 <italic>mg/l</italic> of the media. Single-step Nickel-affinity chromatography was employed for purification of rHuEpo-6xHis to 80% purity. Analyses by SDS-PAGE, Western blot and N-terminal protein sequencing confirmed the authenticity of the 33 <italic>kDa</italic> expressed rHuEpo with a native N-terminal indicating the proper cleavage of secretion-signal. Results of this study, further confirmed the possibility of employing methylotrophic yeast for scaled up production aims of rHuEpo as a cost-efficient expression system when provided evidence for higher expression yields through application of pH-controlled systems.</p>
			</abstract>
			<kwd-group>
				<kwd>Erythropoietin</kwd>
				<kwd>Fermentation</kwd>
				<kwd>Pichia pastoris</kwd>
				<kwd>Yeasts</kwd>
			</kwd-group>
		</article-meta>
	</front>
	<body>
		<sec id="S0001" sec-type="intro">
			<title>Introduction</title>
			<p>Erythropoietin (Epo), a 30-38 <italic>kDa</italic> glycol-protein hormone (exact Molecular Weight-MW depends on degree of glycosylation) is produced mainly by kidney as a 193 amino acids pre-mature protein which stimulates the growth of red blood cells and as a consequence increases haemoglobin levels (<xref ref-type="bibr" rid="CIT0001">1</xref>, <xref ref-type="bibr" rid="CIT0002">2</xref>). Administration of Epo as a therapeutic improves the quality of life in patients with cancer, renal and heart failure anemia (<xref ref-type="bibr" rid="CIT0003">3</xref>).</p>
			<p>To fulfil the high medical demand for Epo globally, large scale production of recombinant Human Epo (rHuEpo) was originally initiated in Chinese Hamster Ovary (CHO) cells (<xref ref-type="bibr" rid="CIT0001">1</xref>). Nonetheless, due to cost-efficiency considerations for scaled up production, more efficient heterologous expression systems, rather than mammalian cells for this valuable drug are being explored.</p>
			<p>To this end, production of Epo in different prokaryotic hosts like <italic>Escherichia coli</italic> (<italic>E. coli</italic>) (<xref ref-type="bibr" rid="CIT0004">4</xref>) and <italic>Bacillus brevis</italic> 
 (<xref ref-type="bibr" rid="CIT0005">5</xref>), as well as eukaryotic hosts such as <italic>Saccharomyces cerevisiae</italic> (<italic>S. cerevisiae</italic>) (<xref ref-type="bibr" rid="CIT0006">6</xref>) and <italic>Drosophila melanogaster</italic> 
 (<xref ref-type="bibr" rid="CIT0007">7</xref>) was described. However, since proper glycosylation of Epo as a hormone is important for some of its functional properties such as biological half-life (<xref ref-type="bibr" rid="CIT0008">8</xref>), neither prokaryote systems lacking the ability to glycosylate proteins nor microbial eukaryotes like <italic>S.cerevisiae</italic> which hyperglycosylates proteins (<xref ref-type="bibr" rid="CIT0009">9</xref>) could be considered as alternatives to currently exploited CHO cells for production of rHuEpo.</p>
			<p>In recent years, a few yeast species capable of growing on methanol as sole carbon and energy source have been identified and their application in biotechnology for high level and cost-efficient production of recombinant proteins with proper post-translational modifications were established (<xref ref-type="bibr" rid="CIT0010">10</xref>). These so called methylotrophic yeasts belong to four genera; <italic>Hansenula, Pichia, Candida</italic> and <italic>Torulopsis</italic> and their most prominent representatives are <italic>Hansenula polymorpha (H. polymorpha), Pichia pastoris (P. pastoris), Candida boidinii</italic> and <italic>Pichia methanolica</italic>, respectively (<xref ref-type="bibr" rid="CIT0011">11</xref>). While <italic>H. polymorpha</italic> and <italic>P. pastoris</italic> are distinguished as industrial platforms for heterologous protein production, the other two methylotrophic yeasts are still in the research level of applications (<xref ref-type="bibr" rid="CIT0012">12</xref>).</p>
			<p>Currently, the heterologous protein expression system of methylotrophic yeast &#x201C;<italic>P. pastoris</italic>&#x201D; is broadly used for production of many human and therapeutic proteins in biopharmaceuticals industries (<xref ref-type="bibr" rid="CIT0013">13</xref>). In fact with the advantages of both prokaryotic and eukaryotic systems and the availability of strong promoter for alcohol oxidase, <italic>AOX1</italic>, which is tightly regulated and induced by addition of methanol to the growth medium, <italic>P. pastoris</italic> provides the potential for producing correctly folded and properly glycosylated recombinant proteins. It often allows the recombinant protein to be secreted in large quantities when it does not secrete significant amounts of intrinsic proteins, a phenomenon that facilitates downstream purification steps (<xref ref-type="bibr" rid="CIT0014">14</xref>).</p>
			<p>However, to transport the expression profile of a new protein from research scale to industrial levels, the possibility of high level expression and purification yields should be proved. In this context, recently, expression of rHuEpo by <italic>P. pastoris</italic> in a batch culture system using baffled flasks is also reported (<xref ref-type="bibr" rid="CIT0002">2</xref>); but the expression level was shown to be as low as 5 <italic>mg/l</italic>. Therefore, for scaled up production purposes, there is absolute need to improve expression/culturing protocols for much higher yields of rHuEpo expression in methylotrophic <italic>Pichia</italic>.
</p>
			<p>Such optimizations may be achieved by exploring better vectors, host strains, and expression clones as well as optimizing the fermentation process to improve the yield and stability of expressed proteins by controlling the medium composition, pH, temperature, methanol induction and feed mode (<xref ref-type="bibr" rid="CIT0015">15</xref>). To this end, more recently higher production levels for <italic>P. pastoris</italic>-derived rHuEpo (130 <italic>mg/l</italic>) by Fed-batch methanol feeding strategy in the presence of co-substrate sorbitol was also described (<xref ref-type="bibr" rid="CIT0016">16</xref>).</p>
			<p>In the present study, we attempted to investigate other fermentation strategies rather than Fed-batch methanol feeding and sorbitol utilization for high yield production of rHuEpo by <italic>P. pastoris</italic> when simultaneously selecting the highest-expressing clones. In this context, we proposed the application of acid feeding strategy to keep buffering and stabilization of the pH around 6.0 throughout the methanol induction period for the selected-high expression Mut<sup>+</sup> (Methanol Utilizing Positive) clone potentially containing multiple copies of the integrated vector. Results obtained in this study demonstrated the possibility of large scale production of rHuEpo in methylotrophic yeast by pH stabilization.
</p>
			<p>To our knowledge, this is the second report on high level expression of rHuEpo in methylotrophic yeast when the first report on optimization of fermentation process through stabilizing the optimum pH and also the first report on production of home-made yeast-derived rHuEpo in Iran.</p>
		</sec>
		<sec id="S0002" sec-type="materials|methods">
			<title>Materials and Methods</title>
			<sec id="S20003">
				<title>Construction of expression vector for secretion of rHuEpo in methylotrophic yeast</title>
				<p>The synthetic cDNA encoding for the 166 native amino acids of the homo sapiens Epo gene (NCBI accession no. NM_000799) in tandem with the DNA sequence of six histidine amino acids (6xHis-tag) located at the C-terminal of Epo which was synthesized and cloned in pUC57 plasmid (Bio Basic Inc, Ontario, Canada) was used as template in PCR reactions throughout this study. For further direct cloning of PCR-amplified products in the <italic>Pichia</italic> expression vector pPICZ&#x3B1;A (Invitrogen), <italic>Xho</italic> I and <italic>Xba</italic> I restriction sites were considered in forward (F-EPO: 5&#x2019; CTCGAGA AAAGAGCCCCACCACGCCTCATC3&#x2019;) and reverse (R-EPO: 5&#x2019; TCTAGATTATCAATG ATGATGATGATGATGTCTGTCCCCTGTCCT 3&#x2019;) primers, respectively (restriction sites are underlined). This cloning strategy provided the <italic>Kex2</italic> cleavage site at the 5&#x2019; ends of the DNA encoding Epo to locate the amplified fragment in frame with secretion sequence (&#x3B1;-factor) under control of <italic>AOX1</italic> promoter while the 6xHis-tag and two termination triplets were located at the 3&#x2019; ends in tandem (<xref ref-type="fig" rid="F0001">Figure 1</xref>).</p>
				<fig id="F0001">
					<label>Figure 1</label>
					<caption>
						<p>Schematic diagram of recombinant pPICZ&#x03B1;A harboring HuEpo gene (PICZ&#x03B1;A-Epo: 4.1 <italic>Kbp</italic>). <italic>Xho</italic> I and <italic>Xba</italic> I denote to the restriction sites employed for directional cloning of Epo gene into pPICZ&#x03B1;A under control of <italic>AOX1</italic> promoter, down stream of secretion signal (&#x03B1;-factor) and cleavage sequence (kex2). <italic>AOX1 TT</italic>, 6xHis and Stop denote to the transcription termination sequence, His tag and stop codons, respectively</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-197-g001.tif" alt-version="no"/>
				</fig>
				<p>DNA amplification was carried out through 30 cycles of denaturation (30 <italic>sec</italic> at 94<italic>&#x00B0;C</italic>), annealing (35 <italic>sec</italic> at 58&#x00B0;<italic>C</italic>) and extension (60 <italic>sec</italic> at 72&#x00B0;<italic>C</italic>), followed by a final elongation (10 <italic>min</italic> at 72<italic>&#x00B0;C</italic>) in a Perkin&#x2013;Elmer thermocycler. Following digestion by <italic>Xho</italic> I and <italic>Xba</italic> I restrictions enzymes and gel purification (QIAquick Gel Extraction Kit, QIAgen), PCR-amplified fragments and PICZ&#x3B1;A vector were mixed in the ligation reaction. The product of ligation reaction was used to transform <italic>E. coli</italic> TOP10 competent cells (Invitrogen) and developed Zeocin resistant bacterial colonies were screened for the presence of the proper recombinant construct. The presence and accuracy of the inserted gene within the expression cassette in the final recombinant PICZ&#x3B1;A-Epo construct was confirmed by both restriction analyses using <italic>Xho</italic> I and <italic>Xba</italic> I enzymes and DNA sequencing reactions using the 5&#x0027;AOX1(5&#x2019;-GACT GGTTCC AATTGACAAGC-3&#x2019;) and 3&#x0027;AOX1 (5&#x2019;-GC AAATGGCATTCTGACATCC-3&#x2019;) primers (Invitrogen) which amplify the expression cassette together with the cloned Epo gene.</p>
			</sec>
			<sec id="S20004">
				<title>Electro-transformation of methylotrophic yeast and selection of expression clones</title>
				<p>Around 10 <italic>&#x00B5;g</italic> of purified PICZ&#x3B1;A-Epo plasmids (using QIAprep Spin Miniprep Kit) were linearized with Sac <italic>I</italic> enzyme (Fermentas) and electroporated into the yeast <italic>P. pastoris</italic>, wild-type host strain X-33 (Invitrogen) in 0.2 <italic>cm</italic> cuvettes at 1.5 <italic>kV</italic> (25 <italic>&#x00B5;F</italic> and 200 &#x03A9;), using a Bio-Rad Gene Pulser according to supplier&#x0027;s instructions (Easy Select <italic>Pichia</italic> Expression manual, Invitrogen).</p>
				<p>Following electroporation, cells (200 <italic>&#x00B5;l</italic>) were plated on YPDS medium (1% Yeast extract, 2% Peptone, 2% Dextrose, 1 <italic>M</italic> Sorbitol) supplemented with 100 <italic>&#x00B5;g/ml</italic> Zeocin and incubated for 3-5 days at 30<italic>&#x00B0;C</italic>. Zeocin-resistant yeast transformants were further transferred on plates containing 1 <italic>mg/ml</italic> Zeocin. Finally, colonies that survived this concentration of Zeocin were screened for confirming the methanol utilization positive phenotype (Mut<sup>+</sup>) according to the supplier&#x0027;s instructions (Invitrogen).</p>
				<p>Briefly, a single colony of each Zeocin resistant transformants was first streaked on a MM (Minimal Methanol) plate and then on a MD (Minimal Dextrose) plate and incubated 2 days at 30 &#x00B0;<italic>C</italic>. Mut<sup>+</sup> transformants were identified through their normal growth on both plates within this time (in these conditions Mut<sup>S</sup> strains only grow on the MD plate and show little or no growth on the MM). From screened Mut<sup>+</sup> transformants that survived a concentration of 1 <italic>mg/ml</italic> Zeocin, 10 colonies were randomly selected and confirmed for the presence of the corresponding Epo gene by PCR using AOX1 primers. Finally, confirmed Mut<sup>+</sup> transformants were analyzed for expression levels in a mini scale (50 <italic>ml</italic> conical tubes containing 10 <italic>ml</italic> of culture media) and the highest expression clone was selected on the basis of ELISA, Western blot and densitometric assays on the culture supernatants as described in the analyses and quantification section in the following.</p>
			</sec>
			<sec id="S20005">
				<title>Optimization of the culturing conditions and purification of rHuEpo in methylotrophic yeast</title>
				<p>A single colony from the highest expressing clones was inoculated into 5 <italic>ml</italic> of YPD (1% yeast extract, 2% peptone and 2% dextrose) +100 <italic>&#x00B5;g/ml</italic> of Zeocin medium and grown overnight at 28-30&#x00B0;<italic>C</italic> (200&#x2013;250 <italic>rpm</italic>). The obtained seed culture was then used to inoculate 100 <italic>ml</italic> of BMGY medium (1% yeast extract, 2% peptone, 1.34% YNB, 4 &#x00D7; 10<sup>
						<bold>-5</bold>
					</sup>% biotin, 1% glycerol and 0.1 <italic>M</italic> potassium phosphate, pH=6.0) in a 500 <italic>ml</italic> Erlenmeyer flask and growth allowed to proceed at 28-30&#x00B0;<italic>C</italic> (200&#x2013;250 <italic>rpm</italic>) for 16 - 18 <italic>hr</italic> (OD<sub>600</sub> &#x223C; 5-7)<sub>.</sub> Subsequently, cells were harvested by centrifugation (3000 <italic>g</italic> for 4 <italic>min</italic>) and the pellet resuspended in 200 <italic>ml</italic> BMMY medium (1% yeast extract, 2% peptone, 1.34% YNB, 4 &#x00D7; 10<sup>
						<bold>&#x2212;5</bold>
					</sup>% biotin, 0.5% methanol and 0.1 <italic>M</italic> potassium phosphate, pH=6) in 1l Erlenmeyer flasks to an OD<sub>600</sub> &#x223C;1 and incubated at 28&#x2013;30<italic>&#x00B0;C</italic> (250 <italic>rpm</italic>) in a floor shaking incubator for 72 <italic>hr</italic>. To maintain induction, sterile 100% methanol was added to a final concentration of 0.5% every 24 <italic>hr</italic> during the expression (post-induction). The pH was kept constant at 6.0 throughout the expression time by checking pH every 24 <italic>hr</italic> and adjusting it with 0.1 <italic>M</italic> phosphoric acid.</p>
				<p>After 72 <italic>hr</italic>, the medium was centrifuged at 10000 <italic>g</italic> for 10 <italic>min</italic>, the cell pellet was discarded and the supernatant was concentrated 10 fold and diafiltrated by Labscale TFF System (Millipore, USA) exploiting Pellicon XL50 ultrafiltration cassette equipped with Ultracel membrane (MWCO of 10 kDa). During diafiltration, the buffer of supernatant was exchanged with 20 <italic>mM</italic> sodium phosphate buffer pH=7, 0.5 <italic>M</italic> sodium chloride. Subsequently, expressed Epo was purified by the Ion Metal Affinity Chromatography (IMAC) columns charged with Ni<sup>2+</sup> according to the supplier instructions with some modifications (His-Trap HP affinity columns, GE Healthcare).</p>
				<p>In brief, each diafiltrated sample was loaded on a prepacked column at a flow rate 0.8 <italic>ml/min</italic> and prewashed with 20&#x2013;30 column volumes of equilibration buffer (20 <italic>mM</italic> sodium phosphate buffer pH=7, 0.5 <italic>M</italic> sodium chloride). Subsequently, purification column was washed with 10 column volumes of washing buffer (equilibration buffer plus 90 <italic>mM</italic> imidazole) and then bound proteins were eluted with elution buffer (equilibration buffer plus 250 <italic>mM</italic> imidazole). Finally imidazole was removed by ultrafiltration using the exchange buffer (50 <italic>mM</italic> sodium phosphate pH=7, 150 <italic>mM</italic> sodium chloride, 10% glycerol) which simultaneously introduced the purified Epo into this final buffer. The purified proteins were stored at -80 &#x00B0;<italic>C</italic> for further analyses.</p>
			</sec>
			<sec id="S20006">
				<title>Analyses and quantification methods of recombinant Epo protein</title>
				<p>Concentrations of the expressed Epo protein in the supernatants were quantified by human Epo ELISA kit (CIGB, Havana, Cuba) according to the supplier instructions. Purified proteins were quantified by both ELISA and the Bradford method (<xref ref-type="bibr" rid="CIT0017">17</xref>). Protein samples were analyzed by the standard Laemmli SDS-PAGE method (<xref ref-type="bibr" rid="CIT0018">18</xref>) in a 12.5% separating gel and developed with silver staining. Further analysis of stained SDS-PAGE slabs for yield measurements was performed by densitometry using a GS-800 Bio-Rad Imaging Densitometer and employing Quantity One analyzer according to the software manual. Western analysis was performed by electroblotting of proteins from SDS-PAGE gel to Whatman nitrocellulose membranes (Schleicher &#x0026; Schuell).</p>
				<p>Tracking of the protein was achieved by employing the monoclonal (mouse) antibody against rHuEpo (CIGB, Havana, Cuba) and/ or monoclonal (mouse) anti-His(C-term) anti-body (Invitrogen) as the primary and horse-radish peroxidase-conjugated goat anti-mouse IgG (Promega Corporation, Madison, WI, USA) as the secondary antibody. The bands were developed using DAB chromogenic substrate (Sigma-Aldrich). N-terminal amino acid sequencing was performed by Edman&#x0027;s degradation method on the purified sample electroblotted onto PVDF membrane (Institut fur Chemeie, Universitat fur Bodenkultur Wien, Austria). Cell concentrations were measured with a Perkin Elmer UV/VIS spectrophotometer (Lambda EZ 201) based on absorbance at 600 <italic>nm</italic> using a calibration curve.</p>
				<p>Statistical analyses of the data were performed using Student&#x0027;s t test and one-way multivariate ANOVA to calculate p value. P&#x003C;0.05 was considered statistically significant.</p>
			</sec>
		</sec>
		<sec id="S0007" sec-type="results">
			<title>Results</title>
			<sec id="S20008">
				<title>PICZ&#x3B1;A-Epo expression vector and selection of yeast transformants</title>
				<p>The human cDNA of Epo which was employed in this study encoded 166 native amino acids of the protein. In our cloning strategy, using <italic>Xho</italic> I and <italic>Xba</italic> I sites of pPICZ&#x3B1;A, the cDNA of Epo was cloned in frame with alcohol oxidase (<italic>AOX1</italic>) transcription/ translational cassette. This strategy inserts the Epo cDNA downstream of the prepro-&#x3B1;-factor sequence and immediately after the <italic>Kex-2</italic> signal cleavage site to express and secrete Epo into the culture media with a native N terminus. Furthermore, two stop codons were placed immediately after the 6xHis-tag codons for preventing of any ribosomal-pass through (<xref ref-type="fig" rid="F0001">Figure 1</xref>).</p>
				<p>The restriction analyses of the constructed recombinant Epo plasmid (<xref ref-type="fig" rid="F0002">Figure 2</xref>) and DNA sequencing analysis demonstrated the correct insert orientation and complete accuracy for the PICZ&#x3B1;A-Epo construct without any unwanted mutations.</p>
				<p>Due to the advantages of electroporation, such as high frequency of transformation (especially possibility of multi-copy insertion), this method was employed to transform yeast cells by the constructed plasmid (PICZ&#x3B1;A-Epo).</p>
				<fig id="F0002">
					<label>Figure 2</label>
					<caption>
						<p>Restriction analysis of PICZ&#x03B1;A-Epo construct (4.1 <italic>Kbp</italic>). DNA fragments were analyzed by 1% agarose gel electrophoresis. Lanes 1 and 4: DNA Ladder SM1163 and SM0321, respectively (Fermentas) Lane 2: Single digestion by <italic>Xba</italic> I (linear construct, 4.1 <italic>Kbp</italic>); Lane 3: Double digestion by <italic>Xho</italic> I and <italic>Xba</italic> I enzymes (linear pPICZ&#x03B1;A and rHuEpo gene are identified as 3.6 <italic>Kbp</italic> and 540 <italic>bp</italic> fragments, respectively)</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-197-g002.tif" alt-version="no"/>
				</fig>
				<p>To reach the highest possible expression levels for our gene of interest (Epo), we primarily tried to select transformants that potentially may contain multiple copies of the integrated vector. For this purpose, transformants that appeared after 3-5 days on plates containing 100 <italic>&#x00B5;g/ml</italic> Zeocin were further transferred on plates containing 1 <italic>mg/ml</italic> Zeocin. Colonies that survive on such a high concentration of Zeocin, potentially may contain multi copies of the cassette inserted into their genome (<xref ref-type="bibr" rid="CIT0019">19</xref>). Moreover, the highest expression clone for scale-up experiment was screened from 20 randomly selected Mut<sup>+</sup>-Zeocin resistant transformants (1 <italic>mg/ml</italic>) by culturing them in small scale (10 <italic>ml</italic>) for comparatively appraising the level of expression among them. It should be noted, however that multiple cassette insertions into the genome of selected transformants should be verified by methods like Southern blotting.</p>
			</sec>
			<sec id="S20009">
				<title>Optimization of media and buffering system of fermentation system for high level expression</title>
				<p>Following the selection of best expression-clone, scaled-up expression of Epo in unbuffered media (simple: 1.34% YNB, 4 x 10<sup>
						<bold>-5</bold>
					</sup>% biotin, 0.5% methanol) and (complex: 1% yeast extract, 2% peptone, 1.34% YNB, 4 x 10<sup>
						<bold>-5</bold>
					</sup>% biotin, 0.5% methanol) was tried, but the expression levels were lower than 1 <italic>mg/l</italic>. This low level expression may be explained by shocking levels of [H<sup>+</sup>] concentration during yeast fermentation (<xref ref-type="bibr" rid="CIT0020">20</xref>). Shocking levels of [H<sup>+</sup>] may be attributed to extreme high or low concentrations of H<sup>+</sup> that could inhibit the expression of the protein during fermentation.</p>
				<p>In fact, by the end of fermentation, utilization of unbuffered simple medium resulted in extreme acidic conditions (pH=3.5), due to apparently production of methanol oxidized metabolites when on the contrary to simple media, the pH for the unbuffered complex medium resulted in extreme basic conditions (pH=8.5) apparently due to the production of ammonium via metabolizing amino acids existing in yeast extract and peptone. This finding for extremely low expression levels of Epo in unbuffered media prompted us to evaluate the effect of different pH values on the level of Epo expression.</p>
				<p>In this context, by adjusting the pH value in a range of 5.0 &#x2013; 7.0 (with 1.0 interval) we found that the expression of Epo in buffered methanol complex medium with a pH=6.0 was higher than other pH ranges (<xref ref-type="fig" rid="F0003">Figure 3A</xref>). Moreover we could show that stabilizing the pH at 6.0 throughout the expression time by addition of 0.1 <italic>M</italic> phosphoric acid in a batch format every 24 <italic>hrs</italic>, led to a considerable increasing of Epo expression level (150 <italic>mg/l</italic>) compared to unstabilized pH conditions (120 <italic>mg/l</italic>) (<xref ref-type="fig" rid="F0003">Figure 3B</xref>).</p>
				<fig id="F0003">
					<label>Figure 3</label>
					<caption>
						<p>A) Effect of different pH values on expression/ secretion level of rHuEpo. Data are the means &#x00B1; SD (n=3 each). B) Influence of pH stabilization at 6 throughout the expression time by addition of 0.1 <italic>M</italic> phosphoric acid in a batch format every 24 <italic>hr</italic>. Data are the means &#x00B1; SD (n=3 each, p-value = 0.014). Expression levels in all the trials were measured at the end of induction period (72 <italic>hr</italic>) by ELISA and Densitometry</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-197-g003.tif" alt-version="no"/>
				</fig>
				<p>It should be noted that a perfect stabilization of pH may be achieved only through application of an automatically-controlled fermenter that adjust the pH through continuous measurement of [H<sup>+</sup>] concentration and feeding acid in a fed-batch format. However, in shake-flask batch system, our observations indicated that up to 12 <italic>hr</italic> of fermentation pH was around 6.5 and by 24 <italic>hr</italic> of fermentation was around 7.0 (still below pH=8.5 and shocking levels of H<sup>+</sup> concentrations as discussed above).</p>
				<p>Therefore adjustment of pH every 24 <italic>hr</italic> could relatively fulfill the required pH stabilization (around 6) in our system. A higher expression level of rHuEpo that obtained at pH 6.0 can be the result of improvement in the yeast growth and/or reduced activity of secreted proteases as previously proposed (<xref ref-type="bibr" rid="CIT0019">19</xref>).</p>
			</sec>
			<sec id="S20010">
				<title>Purification and characterization of methylotrophic yeast-expressed rHuEpo</title>
				<p>Due to the designed and inserted 6xHis-tag at the C terminal of the expressed rHuEpo in the body of PICZ&#x3B1;A-Epo construct, Ion Metal Affinity Chromatography (IMAC) was employed as a single-step purification of the expressed protein with a yield around 80% as determined by densitometry.</p>
				<p>As shown in <xref ref-type="fig" rid="F0004">figure 4</xref>, yeast-derived rHuEpo migrated on the SDS-PAGE gel with an apparent mass of 33 <italic>kDa</italic> under denaturing conditions and was properly detected by monoclonal anti-rHuEpo antibody (<xref ref-type="fig" rid="F0004">Figure 4B</xref>) and monoclonal anti-His antibody (data not shown) in Western analyses.</p>
				<p>To further identify and characterize the protein band corresponding to 33 <italic>kDa</italic>, N-terminal amino acid sequence analysis was performed on this 33 <italic>kDa</italic> band. The first 10 N- terminal residues in the 33 <italic>kDa</italic> band were found to be identical to the mature amino acid-deduced from cDNA sequence of rHuEpo, <italic>i.e</italic>. APPRLI? DSR (Cys7 couldn&#x0027;t be detected directly due to its engagement in disulfide bond formation) and showed complete processing and removal of prepro-&#x3B1;-factor sequence in this band.</p>
				<fig id="F0004">
					<label>Figure 4</label>
					<caption>
						<p>Analyses of <italic>P.pastoris</italic>-secreted rHuEpo by SDS-PAGE and western blotting. A) Silver stained SDS-PAGE view of different steps in purification of the rHuEpo by IMAC. Lane C: <italic>P.pastoris</italic> (wild type X-33) transformed with PICZ&#x03B1;A plasmid without the inserted Epo gene (control negative); Lane 1: loaded sample (concentrated supernatant); Lane 2: flow through of loading and prewashing; Lane 3: flow through of washing; Lane 4: Eluted (purified) <italic>Pichia</italic>-derived rHuEpo protein; M: Protein size marker SM0431 (Fermentas). B) Western blot view of crude and concentrated supernatant rHuEpo (Lane 1), flow through of loading and prewashing (Lane 2) and eluted (purified) <italic>Pichia</italic>-derived rHuEpo protein (Lane 3) using monoclonal anti-human Epo antibody</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-197-g004.tif" alt-version="no"/>
				</fig>
				<p>As it can be seen in <xref ref-type="fig" rid="F0004">figures 4A</xref> and <xref ref-type="fig" rid="F0004">4B</xref> some notable bands in the region of 42-45<italic>kDa</italic> are also present in the purified fraction. With respect to the molecular weights of these bands and also their interaction with monoclonal anti-rHuEpo antibodies in Western blot analyses, these bands may indicate the unprocessed pro-&#x3B1;-factor/ Epo proteins that resulted from inefficient Kex2 endoprotease processing.</p>
			</sec>
		</sec>
		<sec id="S0011" sec-type="discussion">
			<title>Discussion</title>
			<p>Although, expression of rHuEpo by <italic>P. pastoris</italic> in a batch culture system using baffled flasks was demonstrated (<xref ref-type="bibr" rid="CIT0002">2</xref>), their reported expression level was as low as 5 <italic>mg/l</italic> which is not an appreciated yield for scaled-up production aims.</p>
			<p>The present study was undertaken to investigate possibility of application of other fermentation strategies rather than fed-batch methanol feeding and sorbitol utilization for high yield production of rHuEpo by <italic>P. pastoris</italic> (130 <italic>mg/l</italic>) which was reported recently (<xref ref-type="bibr" rid="CIT0016">16</xref>) and to confirm possibility of scaled up production of rHuEpo by methylotrophic yeast. To our knowledge, this is the second report on high level expression of rHuEpo in methylotrophic yeast when the first report on optimization of fermentation process through stabilizing the pH and from a national point of view it is the first report on home-made production of yeast-derived rHuEpo.</p>
			<p>While described capacities for recombinant protein production by <italic>P. pastoris</italic> varies from 1 to 10 000 <italic>mg/l</italic> 
 (<xref ref-type="bibr" rid="CIT0015">15</xref>), expression levels for rHuEpo reported in the present study (150 <italic>mg/l</italic>) provides sufficient deserve for future large scale plans on methylotrophic yeast-derived Epo production. In fact, by optimizing other factors involved in the fermentation process of methylotrophic yeasts such as temperature, induction mass, methanol concentration and feed mode through application of a controlled-continuous culturing system it may be possible to attain much higher yields for scaled-up applications (<xref ref-type="bibr" rid="CIT0015">15</xref>). Moreover, by employing other strategies like addition of detergents such as different Tweens (20, 40, 60, 65 or 80) and/or addition of co-substrates such as sorbitol even higher yields of expression may be achieved (<xref ref-type="bibr" rid="CIT0016">16</xref>, <xref ref-type="bibr" rid="CIT0021">21</xref>).</p>
			<p>Generally high level expression of a gene of interest depends upon the generation and detection of a recombinant strain that contains multiple copies integrated at the <italic>AOX1</italic> locus (<xref ref-type="bibr" rid="CIT0022">22</xref>). Because of the low frequency of multiple gene insertion events (between 1 and 10% of all selected Zeocin resistant transformants), there is a necessity of screening a large number of Zeocin-resistant transformants to locate these valuable clones.</p>
			<p>In the previous report on rHuEpo expression in <italic>P. pastoris</italic> 
 (<xref ref-type="bibr" rid="CIT0002">2</xref>), the Lithium chloride transformation method was used to transform yeast cells by the recombinant plasmid, where as application of electroporation in our study provided higher transformation frequencies as well as higher possibility of obtaining transformants with multi-copies of integrated vector (Easy Select <italic>Pichia</italic> Expression manual, Invitrogen). Therefore, providing a number of transformed colonies to be screened for their resistance to higher concentration of Zeocin (1 <italic>mg/ml</italic>), indicated the potential for the presence of multi-copies of expression cassette integrated into the genome (<xref ref-type="bibr" rid="CIT0022">22</xref>) and still possibility for selection of the best expression clones by ELISA among a number of screened transformants in small scale expression trials, enabled us to find the highest Epo producing clone.</p>
			<p>Moreover, in our investigation the level of Epo expression was improved noticeably through application of a batch culturing strategy by adding acid to maintain the pH at 6.0 (<xref ref-type="fig" rid="F0003">Figure 3B</xref>). These results are in line with many previous reports on the importance of the [H<sup>+</sup>] concentration and specially pH stabilization at 6.0 during yeast induction period for the highest yields of expression of some other heterologous proteins (<xref ref-type="bibr" rid="CIT0015">15</xref>, <xref ref-type="bibr" rid="CIT0023">23</xref>&#x2013;<xref ref-type="bibr" rid="CIT0026">26</xref>). However, it is important to note that the optimum pH for obtaining the highest level of expression in <italic>P. pastoris</italic> is a protein-specific factor and greatly depends on physico-chemical properties of the expressed protein that should be determined empirically and as a result, other optimum pH values have been already described for different proteins (<xref ref-type="bibr" rid="CIT0027">27</xref>, <xref ref-type="bibr" rid="CIT0028">28</xref>).</p>
			<p>Celik et al (<xref ref-type="bibr" rid="CIT0002">2</xref>) reported the apparent MW of 32 <italic>kDa</italic> for <italic>P.pastoris</italic> expressed rHuEpo on the SDS-PAGE gel which was 2 <italic>kDa</italic> heavier than the average MW of this protein (30 <italic>kDa</italic>) as determined by MALDI-TOF analysis. In agreement with these results, our purified <italic>P. pastoris</italic> expressed Epo with 166 amino acids and 6XHis-tag (which made it about 1 <italic>kDa</italic> heavier) had the apparent MW of 33 <italic>kDa</italic> under denaturing conditions.</p>
			<p>As shown by SDS-PAGE and Western blot analyses (<xref ref-type="fig" rid="F0004">Figures 4A</xref> and <xref ref-type="fig" rid="F0004">4B</xref>), in addition to the main rHuEpo band (33 <italic>kDa</italic>), some faint bands in the range of 42 - 45 <italic>kDa</italic> were also detected by both anti-His and anti-Epo antibodies. Incidence of these protein bands may be explained by occurrence of the uncleaved pro-&#x3B1;-factor/ Epo which were secreted into the culture media as fusion proteins. In this context, the variation in mobility between the bands in 42 - 45 <italic>kDa</italic> regions may reflect differential trimming of core oligosaccharides on the pro region segment; as this region contains three sites for Aspargine-linked glycosylation and complete or partial glycosylation of these sites may result to slightly different MWs (<xref ref-type="bibr" rid="CIT0029">29</xref>). The phenomenon of secretion of proteins in fusion with pro-&#x3B1;-factor into the media has been already reported and is the reflection of insufficient Kex2 endoprotease processing to remove the &#x3B1;-factor secretory signal from protein (<xref ref-type="bibr" rid="CIT0009">9</xref>, <xref ref-type="bibr" rid="CIT0030">30</xref>).</p>
			<p>Epo contains three complex type N-glycans located at asparagine (Asn) residues at positions 24, 38 and 83, and a mucin-type O-glycan located at Ser-126. Proper glycosylation of Epo is not required for its receptor binding but it is however quite essential for elongation of its biological half-life (<xref ref-type="bibr" rid="CIT0008">8</xref>). Although glycosylation pattern of CHO and <italic>P. pastoris</italic> may differ to some extent, but still glycosylation pattern of secreted proteins by <italic>P. pastoris</italic> is the most similar pattern to mammalian cells (<xref ref-type="bibr" rid="CIT0013">13</xref>).</p>
			<p>In addition, according to recent reports on availability of engineered and humanized <italic>P. pastoris</italic> to secrete human glycoproteins with fully complex terminally sialylated N-glycans (<xref ref-type="bibr" rid="CIT0031">31</xref>), this expression system will become indispensable for the production of therapeutic proteins such as rHuEpo.</p>
		</sec>
		<sec id="S0012" sec-type="conclusion">
			<title>Conclusion</title>
			<p>In summary, results of this study indicated that with employing a proper cloning strategy and screening of transformants potentially containing multi-copies of the integrated expression cassette as well as improving fermentation conditions such as feeding acid in a fed-batch culturing strategy for stabilization of pH at 6.0, it is possible to reach yields of 150 <italic>mg/l</italic> or higher of methylotrophic yeast-derived rHuEpo. Data evidenced in this report demonstrated that <italic>P. pastoris</italic> has the potential for production of low-cost Epo and merits further scaled-up studies in more sophisticated and controlled production bioreactors.</p>
		</sec>
	</body>
	<back>
	<ack><title>Acknowledgement</title>
	<p>This work was supported by Pasteur Institute of Iran and Tehran University of Medical Science &#x201C;Faculty of Pharmacy&#x201D;.</p></ack>
		<ref-list>
			<title>References</title>
			<ref id="CIT0001">
				<label>1</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Egrie</surname>
							<given-names>J</given-names>
						</name>
					</person-group>
					<article-title>The cloning and production of recombinant human erythropoietin</article-title>
					<source>Pharmacotherapy</source>
					<year>1990</year>
					<volume>10</volume>
					<issue>Pt 2</issue>
					<fpage>3S</fpage>
					<lpage>8S</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0002">
				<label>2</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Celik</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>Calik</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Halloran</surname>
							<given-names>SM</given-names>
						</name>
						<name>
							<surname>Oliver</surname>
							<given-names>SG</given-names>
						</name>
					</person-group>
					<article-title>Production of recombinant human erythropoietin from Pichia pastoris and its structural analysis</article-title>
					<source>J Appl Microbiol</source>
					<year>2007</year>
					<volume>103</volume>
					<issue>6</issue>
					<fpage>2084</fpage>
					<lpage>2094</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0003">
				<label>3</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Elliott</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Pham</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>Macdougall</surname>
							<given-names>IC</given-names>
						</name>
					</person-group>
					<article-title>Erythropoietins: a common mechanism of action</article-title>
					<source>Exp Hematol</source>
					<year>2008</year>
					<volume>36</volume>
					<issue>12</issue>
					<fpage>1573</fpage>
					<lpage>84</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0004">
				<label>4</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lee-Huang</surname>
							<given-names>S</given-names>
						</name>
					</person-group>
					<article-title>Cloning and expression of human erythropoietin cDNA in Escherichia coli</article-title>
					<source>Proc Natl Acad Sci USA</source>
					<year>1984</year>
					<volume>81</volume>
					<issue>9</issue>
					<fpage>2708</fpage>
					<lpage>2712</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0005">
				<label>5</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Nagao</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Inoue</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Moon</surname>
							<given-names>SK</given-names>
						</name>
						<name>
							<surname>Masuda</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Takagi</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Udaka</surname>
							<given-names>S</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Secretory production of erythropoietin and the extracellular domain of the erythropoietin receptor by Bacillus brevis: affinity purification and characterization</article-title>
					<source>Biosci Biotechnol Biochem</source>
					<year>1997</year>
					<volume>61</volume>
					<issue>4</issue>
					<fpage>670</fpage>
					<lpage>674</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0006">
				<label>6</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Elliott</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Giffin</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Suggs</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Lau</surname>
							<given-names>EP</given-names>
						</name>
						<name>
							<surname>Banks</surname>
							<given-names>AR</given-names>
						</name>
					</person-group>
					<article-title>Secretion of glycosylated human erythropoietin from yeast directed by the alpha-factor leader region</article-title>
					<source>Gene</source>
					<year>1989</year>
					<volume>79</volume>
					<issue>1</issue>
					<fpage>167</fpage>
					<lpage>180</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0007">
				<label>7</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kim</surname>
							<given-names>YK</given-names>
						</name>
						<name>
							<surname>Shin</surname>
							<given-names>HS</given-names>
						</name>
						<name>
							<surname>Tomiya</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Lee</surname>
							<given-names>YC</given-names>
						</name>
						<name>
							<surname>Beten-baugh</surname>
							<given-names>MJ</given-names>
						</name>
						<name>
							<surname>Cha</surname>
							<given-names>HJ</given-names>
						</name>
					</person-group>
					<article-title>Production and N-glycan analysis of secreted human erythropoietin glycoprotein in stably transfected Drosophila S2 cells</article-title>
					<source>Biotechnol Bioeng</source>
					<year>2005</year>
					<volume>92</volume>
					<issue>4</issue>
					<fpage>452</fpage>
					<lpage>461</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0008">
				<label>8</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Takeuchi</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Takasaki</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Shimada</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Kobata</surname>
							<given-names>A</given-names>
						</name>
					</person-group>
					<article-title>Role of sugar chains in the in vitro biological activity of human erythropoietin produced in recombinant Chinese hamster ovary cells</article-title>
					<source>J Biol Chem</source>
					<year>1990</year>
					<volume>265</volume>
					<fpage>12127</fpage>
					<lpage>12130</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0009">
				<label>9</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kjeldsen</surname>
							<given-names>T</given-names>
						</name>
					</person-group>
					<article-title>Yeast secretory expression of insulin precursors</article-title>
					<source>Appl Microbiol Biotechnol</source>
					<year>2000</year>
					<volume>54</volume>
					<issue>3</issue>
					<fpage>277</fpage>
					<lpage>286</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0010">
				<label>10</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Gellissen</surname>
							<given-names>G</given-names>
						</name>
					</person-group>
					<article-title>Heterologous protein production in methylotrophic yeasts</article-title>
					<source>Appl Microbiol Biotechnol</source>
					<year>2000</year>
					<volume>54</volume>
					<issue>6</issue>
					<fpage>741</fpage>
					<lpage>750</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0011">
				<label>11</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hartner</surname>
							<given-names>FS</given-names>
						</name>
						<name>
							<surname>Glieder</surname>
							<given-names>A</given-names>
						</name>
					</person-group>
					<article-title>Regulation of methanol utilisation pathway genes in yeasts</article-title>
					<source>Microbial Cell Fact</source>
					<year>2006</year>
					<volume>5</volume>
					<fpage>39</fpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0012">
				<label>12</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Yurimoto</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Sakai</surname>
							<given-names>Y</given-names>
						</name>
					</person-group>
					<article-title>Methanol-inducible gene expression and heterologous protein production in the methylotrophic yeast Candida boidinii</article-title>
					<source>Biotechnol Appl Biochem</source>
					<year>2009</year>
					<volume>53</volume>
					<issue>Pt 2</issue>
					<fpage>85</fpage>
					<lpage>92</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0013">
				<label>13</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Bollok</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Resina</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Valero</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Ferrer</surname>
							<given-names>P</given-names>
						</name>
					</person-group>
					<article-title>Recent patents on the Pichia pastoris expression system: expanding the toolbox for recombinant protein production</article-title>
					<source>Recent Pat Biotechnol</source>
					<year>2009</year>
					<volume>3</volume>
					<issue>3</issue>
					<fpage>192</fpage>
					<lpage>201</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0014">
				<label>14</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Daly</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Hearn</surname>
							<given-names>MT</given-names>
						</name>
					</person-group>
					<article-title>Expression of heterologous proteins in Pichia pastoris: a useful experimental tool in protein engineering and production</article-title>
					<source>J Mol Recognit</source>
					<year>2005</year>
					<volume>18</volume>
					<issue>2</issue>
					<fpage>119</fpage>
					<lpage>138</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0015">
				<label>15</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Li</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Anumanthan</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Gong Gao</surname>
							<given-names>X</given-names>
						</name>
						<name>
							<surname>Ilangovan</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Suzara</surname>
							<given-names>VV</given-names>
						</name>
						<name>
							<surname>D&#x00FC;zg&#x00FC;ne&#351;</surname>
							<given-names>N</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Expression of recombinant proteins in Pichia pastoris</article-title>
					<source>Appl Biochem Biotechnol</source>
					<year>2007</year>
					<volume>142</volume>
					<issue>2</issue>
					<fpage>105</fpage>
					<lpage>124</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0016">
				<label>16</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Celik</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>CalIk</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Oliver</surname>
							<given-names>S</given-names>
						</name>
					</person-group>
					<article-title>Fed-batch methanol feeding strategy for recombinant protein production by Pichia pastoris in the presence of co-substrate sorbitol</article-title>
					<source>Yeast</source>
					<year>2009</year>
					<volume>26</volume>
					<issue>9</issue>
					<fpage>473</fpage>
					<lpage>484</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0017">
				<label>17</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Bradford</surname>
							<given-names>MM</given-names>
						</name>
					</person-group>
					<article-title>A rapid and sensitive for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding</article-title>
					<source>Anal Biochem</source>
					<year>1976</year>
					<volume>72</volume>
					<issue>1-2</issue>
					<fpage>248</fpage>
					<lpage>254</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0018">
				<label>18</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Laemmli</surname>
							<given-names>UK</given-names>
						</name>
					</person-group>
					<article-title>Cleavage of structural proteins during assembly of head of bacteriophage-T4</article-title>
					<source>Nature</source>
					<year>1970</year>
					<volume>227</volume>
					<fpage>680</fpage>
					<lpage>685</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0019">
				<label>19</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Clare</surname>
							<given-names>JJ</given-names>
						</name>
						<name>
							<surname>Romanos</surname>
							<given-names>MA</given-names>
						</name>
						<name>
							<surname>Rayment</surname>
							<given-names>FB</given-names>
						</name>
						<name>
							<surname>Rowedder</surname>
							<given-names>JE</given-names>
						</name>
						<name>
							<surname>Smith</surname>
							<given-names>MA</given-names>
						</name>
						<name>
							<surname>Payne</surname>
							<given-names>MM</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Production of mouse epidermal growth factor in yeast: high-level secretion using Pichia pastoris strains containing multiple gene copies</article-title>
					<source>Gene</source>
					<year>1991</year>
					<volume>105</volume>
					<issue>2</issue>
					<fpage>205</fpage>
					<lpage>212</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0020">
				<label>20</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Couderc</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Baratti</surname>
							<given-names>J</given-names>
						</name>
					</person-group>
					<article-title>Oxidation of methanol by the yeast, Pichia pastoris. Purification and properties of the alcohol oxidase</article-title>
					<source>Agric Biol Chem</source>
					<year>1980</year>
					<volume>44</volume>
					<fpage>2279</fpage>
					<lpage>2289</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0021">
				<label>21</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Apte-Deshpande</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Somani</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Mandal</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Soorapaneni</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Padmanabhan</surname>
							<given-names>S</given-names>
						</name>
					</person-group>
					<article-title>Over expression and analysis of O-glycosylated recombinant human granulocyte colony stimulating factor in Pichia pastoris using Agilent 2100 Bioanalyzer</article-title>
					<source>J Biotechnol</source>
					<year>2009</year>
					<volume>143</volume>
					<issue>1</issue>
					<fpage>44</fpage>
					<lpage>50</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0022">
				<label>22</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Cregg</surname>
							<given-names>JM</given-names>
						</name>
						<name>
							<surname>Cereghino</surname>
							<given-names>JL</given-names>
						</name>
						<name>
							<surname>Shi</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Higgins</surname>
							<given-names>DR</given-names>
						</name>
					</person-group>
					<article-title>Recombinant protein expression in Pichia pastoris</article-title>
					<source>Mol Biotechnol</source>
					<year>2000</year>
					<volume>16</volume>
					<issue>1</issue>
					<fpage>23</fpage>
					<lpage>52</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0023">
				<label>23</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Su</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Xu</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Wang</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Zhou</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Niu</surname>
							<given-names>C</given-names>
						</name>
						<name>
							<surname>Yan</surname>
							<given-names>W</given-names>
						</name>
					</person-group>
					<article-title>High yield and purification of recombinant human apolipoprotein E3 in Pichia pastoris</article-title>
					<source>Protein Expr Purif</source>
					<year>2009</year>
					<volume>68</volume>
					<issue>1</issue>
					<fpage>7</fpage>
					<lpage>11</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0024">
				<label>24</label>
				<nlm-citation citation-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Prevatt</surname>
							<given-names>WD</given-names>
						</name>
						<name>
							<surname>Sreekrishna</surname>
							<given-names>K</given-names>
						</name>
						<collab>inventors</collab>
					</person-group>
					<article-title>Expression of human serum albumin in Pichia pastoris</article-title>
					<year>1994</year>
					<month>Jul</month>
					<day>19</day>
					<publisher-name>Research Corporation Technologies Inc., assignee</publisher-name>
					<comment>United States patent US 5,330,901</comment>
				</nlm-citation>
			</ref>
			<ref id="CIT0025">
				<label>25</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pa&#x00ED;s-Chanfrau</surname>
							<given-names>JM</given-names>
						</name>
						<name>
							<surname>Garc&#x00ED;a</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Licor</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Besada</surname>
							<given-names>V</given-names>
						</name>
						<name>
							<surname>Castellanos-Serra</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Cabello</surname>
							<given-names>CI</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Improving the expression of mini-proinsulin in Pichia pastoris</article-title>
					<source>Biotechnol Lett</source>
					<year>2004</year>
					<volume>26</volume>
					<issue>4</issue>
					<fpage>1269</fpage>
					<lpage>1272</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0026">
				<label>26</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Liu</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Lin</surname>
							<given-names>Q</given-names>
						</name>
						<name>
							<surname>Sun</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Qiu</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Xu</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Ding</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Guo</surname>
							<given-names>X</given-names>
						</name>
					</person-group>
					<article-title>Optimization of fermentation conditions for maximal recombinant hepatitis B surface antigen particle production in Pichia pastoris</article-title>
					<source>Sheng Wu Gong Cheng Xue Bao</source>
					<year>2008</year>
					<volume>24</volume>
					<issue>12</issue>
					<fpage>2098</fpage>
					<lpage>2105</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0027">
				<label>27</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Lin</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Kim</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Xiong</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Yang</surname>
							<given-names>X</given-names>
						</name>
					</person-group>
					<article-title>Enhancing the production of Fc fusion protein in fed-batch fermentation of Pichia pastoris by design of experiments</article-title>
					<source>Biotechnol Prog</source>
					<year>2007</year>
					<volume>23</volume>
					<issue>3</issue>
					<fpage>621</fpage>
					<lpage>625</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0028">
				<label>28</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Vellanki</surname>
							<given-names>RN</given-names>
						</name>
						<name>
							<surname>Potumarthi</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Mangamoori</surname>
							<given-names>LN</given-names>
						</name>
					</person-group>
					<article-title>Constitutive expression and optimization of nutrients for streptokinase production by Pichia pastoris using statistical methods</article-title>
					<source>Appl Biochem Biotechnol</source>
					<year>2009</year>
					<volume>158</volume>
					<issue>1</issue>
					<fpage>25</fpage>
					<lpage>40</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0029">
				<label>29</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kukuruzinska</surname>
							<given-names>MA</given-names>
						</name>
						<name>
							<surname>Bergh</surname>
							<given-names>MLE</given-names>
						</name>
						<name>
							<surname>Jackson</surname>
							<given-names>BJ</given-names>
						</name>
					</person-group>
					<article-title>Protein glycosylation in yeast</article-title>
					<source>Annu Rev Biochem</source>
					<year>1987</year>
					<volume>56</volume>
					<fpage>915</fpage>
					<lpage>944</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0030">
				<label>30</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Zsebo</surname>
							<given-names>KM</given-names>
						</name>
						<name>
							<surname>Lu</surname>
							<given-names>HS</given-names>
						</name>
						<name>
							<surname>Fieschko</surname>
							<given-names>JC</given-names>
						</name>
						<name>
							<surname>Goldstein</surname>
							<given-names>L</given-names>
						</name>
						<name>
							<surname>Davis</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Duker</surname>
							<given-names>K</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Protein secretion from Saccharomyces cerevisiae directed by the prepro-alpha-factor leader region</article-title>
					<source>J Biol Chem</source>
					<year>1986</year>
					<volume>261</volume>
					<fpage>5858</fpage>
					<lpage>5865</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0031">
				<label>31</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hamilton</surname>
							<given-names>SR</given-names>
						</name>
						<name>
							<surname>Davidson</surname>
							<given-names>RC</given-names>
						</name>
						<name>
							<surname>Sethuraman</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Nett</surname>
							<given-names>JH</given-names>
						</name>
						<name>
							<surname>Jiang</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Rios</surname>
							<given-names>S</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Humanization of yeast to produce complex terminally sialylated glycoproteins</article-title>
					<source>Science</source>
					<year>2006</year>
					<volume>313</volume>
					<issue>5792</issue>
					<fpage>1441</fpage>
					<lpage>1443</lpage>
				</nlm-citation>
			</ref>
		</ref-list>
	</back>
</article>
