<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" article-type="research-article" xml:lang="en">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">AJMB</journal-id>
			<journal-title>Avicenna Journal of Medical Biotechnology</journal-title>
			<issn pub-type="ppub">2008-2835</issn>
			<issn pub-type="epub">2008-4625</issn>
			<publisher>
				<publisher-name>Avicenna Research Institute</publisher-name>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="publisher-id">AJMB-2-181</article-id>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Original Article</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>Regulation Studies of Telomerase Gene in Cancer Cells by Lentinan</article-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author" corresp="yes">
					<name>
						<surname>Sreenivasulu</surname>
						<given-names>Kamma</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
					<xref ref-type="corresp" rid="cor1">&#x002A;</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Vijayalakshmi</surname>
						<given-names>Muvva</given-names>
					</name>
					<xref ref-type="aff" rid="AF0002">2</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Sambasivarao</surname>
						<given-names>Krothapalli RS</given-names>
					</name>
					<xref ref-type="aff" rid="AF0003">3</xref>
				</contrib>
			</contrib-group>
			<aff id="AF0001">
				<label>1</label>Department of Biotechnology, KL University, India</aff>
			<aff id="AF0002">
				<label>2</label>Department of Botany and Microbiology, Acharya Nagarjuna University, India</aff>
			<aff id="AF0003">
				<label>3</label>Department of Biotechnology, Acharya Nagarjuna University, India</aff>
			<author-notes>
				<corresp id="cor1">
				<label>&#x002A;</label>
					<bold>Corresponding author:</bold> Kamma Sreenivasulu, Ph.D., Department of Biotechnology, KL University, Vaddeswaram, India. <bold>E-mail:</bold> <email xlink:href="sathwik.kamma@gmail.com">sathwik.kamma@gmail.com</email>
				</corresp>
			</author-notes>
			<pub-date pub-type="ppub">
				<season>October-December</season>
				<year>2010</year>
			</pub-date>
			<volume>2</volume>
			<issue>4</issue>
			<fpage>181</fpage>
			<lpage>185</lpage>
			<history>
				<date date-type="received">
					<day>18</day>
					<month>09</month>
					<year>2010</year>
				</date>
				<date date-type="accepted">
					<day>09</day>
					<month>12</month>
					<year>2010</year>
				</date>
			</history>
			<permissions>
				<copyright-statement>Copyright &#x00A9; 2010 Avicenna Research Institute</copyright-statement>
				<copyright-year>2010</copyright-year>
				<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">
					<p>This work is licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly.</p>
				</license>
			</permissions>
			<abstract>
					<p>Lentinan a polysaccharide from medicinal mushroom i.e <italic>Lentinus</italic>, has been known to have anticancer properties. Telomerase activity is not observed in normal healthy cells, whereas in cancerous cells telomerase expression is high. Telomerase represents a promising cancer therapeutic target. We investigated the inhibitory effect of lentinan on telomerase reverse transcriptase gene (hTERT) which is essential for telomerase activity. To assess the transcriptional effect, DLD -1 cancer cells were cultured in the presence of various concentrations of lentinan. TRAP assay, RT-PCR analysis were performed to find telomerase activity and hTERT gene expression respectively. Since C-myc is known to regulate hTERT, expression of C-myc was also determined. Culturing cells with lentinan resulted in down regulation of hTERT and C-myc expression. These results indicate that lentinan inhibits telomerase activity by down regulating hTERT expression via suppression of C-myc in cancer cells.</p>
			</abstract>
			<kwd-group>
				<kwd>C-myc gene</kwd>
				<kwd>Gene expression</kwd>
				<kwd>hTERT</kwd>
				<kwd>Lentinan</kwd>
				<kwd>Telomerase</kwd>
			</kwd-group>
		</article-meta>
	</front>
	<body>
		<sec id="S0001" sec-type="intro">
			<title>Introduction</title>
			<p>Human telomerase is a ribonucleoprotein that adds TTAGGG repeats to telomere ends (<xref ref-type="bibr" rid="CIT0001">1</xref>). Telomerase activity is not detectable in normal cells, with exception of germ cells and renewal tissues. However, it is present in 80&#x2013;90% of human cancer specimens (<xref ref-type="bibr" rid="CIT0002">2</xref>).</p>
			<p>Telomerase comprises three major components <italic>i.e</italic>. htr (human telomerase RNA component), tp1 (telomerase associate protein) and hTERT (human telomerase reverse transcriptase) (<xref ref-type="bibr" rid="CIT0003">3</xref>). Amongst these three components, hTERT plays a key role in telomerase activation. Of the possible regulators C-myc is known to down regulate the expression of hTERT.</p>
			<p>Telomerase inhibitors can be divided into two groups (<xref ref-type="bibr" rid="CIT0004">4</xref>). One group binds to telomerase and blocks its activity, whereas others are suppressors of mRNA expression of hTERT resulting in altered telomerase activity (<xref ref-type="bibr" rid="CIT0005">5</xref>).</p>
			<p>Lentinan is a &#x3B2;-glucan with a glycosidic &#x3B2;-1,3:&#x3B2;-1,6 linkage (<xref ref-type="fig" rid="F0001">Figure 1</xref>). It is an anti-tumor polysaccharide from the shiitake (<italic>Lentinulaedodes</italic>) mushroom. Lentinan is a polysaccharide which is free of nitrogen, and has a molecular weight of approximately 500,000 <italic>Da</italic>. The Japanese pharmaceutical company Ajinomoto developed Lentinan, which is an intravenously administered anti-cancer agent. Lentinan is one of the host-mediated anti-cancer drugs which has been shown to affect host defense immune systems (<xref ref-type="bibr" rid="CIT0006">6</xref>). Limited clinical studies of cancer patients have associated lentinan with a higher survival rate, higher quality of life, and lower re-occurrence of cancer (<xref ref-type="bibr" rid="CIT0007">7</xref>).</p>
			<fig id="F0001">
				<label>Figure 1</label>
				<caption>
					<p>Lentinan beta glucan structure</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-181-g001.tif" alt-version="no"/>
			</fig>
			<p>The aim of present study is to determine the effect of lentinan on gene expression regulation of hTERT and C-myc.</p>
		</sec>
		<sec id="S0002" sec-type="materials|methods" >
			<title>Materials and Methods</title>
			<p>Lentinan was isolated from <italic>lentinusedodes</italic> (Yap and Ng, 2001). DLD-1 gastric cancer cell lines were cultured in RPMI-1640 medium containing freshly prepared DMSO solution of lentinan at various concentrations (0, 2, 4, 6, 8, 10 <italic>ug/ml</italic>). The final concentration of DMSO in the medium is 0.1% (v/v). Control cells were grown in medium supplemented with 0.1% DMSO.</p>
			<p>Cytotoxicity of cell was evaluated by MTT assay which is based on the conversion of MTT to MTT-formazan by mitochondrial enzymes as previously described (<xref ref-type="bibr" rid="CIT0008">8</xref>).</p>
			<sec id="S20003">
				<title>Telomerase activity</title>
				<p>Telomerase activity was measured by PCR based TRAP as previously described (<xref ref-type="bibr" rid="CIT0009">9</xref>) using TRAPEZE ELISA telomerase detection kit based protocol (Chemicon, CA, USA).</p>

<p>The brief procedure is as follows: 5&#x00D7;10<sup>5</sup> cells per well were seeded in 6-well plate and incubated with lentinan mixture at the above specified concentrations for 48 <italic>hrs</italic> at 37 &#x00B0;<italic>C</italic>. The cell pellet was then cooled on ice, lysed with CHAPS lysis (10 mMTris&#x2013;HCl (pH = 7.5), 1 <italic>mM</italic> MgCl2, 1 <italic>mM</italic> EDTA, 0.1 <italic>mM</italic> phenylmethyl sulfonylfluoride, 5 <italic>mM</italic> -mercaptoethanol, 0.5% (3-(3-cholamidopro-pyl) dimethylamino-1- propanesulfonate, and 10% glycerol) buffer for 30 <italic>min</italic> and centrifuged at 12,000&#x00D7;<italic>g</italic> at 4 <italic>&#x00B0;C</italic> for 20 <italic>min</italic>.</p>
				<p>The TRAP PCR reaction mixture contains 1 <italic>&#x00B5;g</italic> of protein from each cell extraction, a mixture of biotinylated TS primer, RP primer, internal control (K1primer and TSK1 template), 2.5 mMdNTPs and 2 <italic>units</italic> Taq DNA polymerase. The PCR was performed for 33 cycles at 94 &#x00B0;<italic>C</italic> for 30 <italic>sec</italic>, 55 &#x00B0;<italic>C</italic> for 30 <italic>sec</italic>, 72 &#x00B0;<italic>C</italic> for 30 <italic>sec</italic> and followed by final extension at 72 &#x00B0;<italic>C</italic> for 10 <italic>min</italic>. The PCR product was separated for determining the degree of telomeric repeats (by 10% non-denaturing polyacrylamide gel electrophoresis) and the telomerase level (by ELISA detection) as described below.</p>
			</sec>
			<sec id="S20004">
				<title>Gene expression of hTERT, C-myc and &#x3B2;-actin</title>
				<p>After cultivation, total RNA was isolated from cells with total RNA extraction kit (qiagen). RT-PCR was performed as per kit (bio-rad) as per manufactures instructions using following primer (<xref ref-type="table" rid="T0001">Table 1</xref>).
</p>
				<table-wrap id="T0001">
				<label>Table 1</label>
					<caption>
						<p>List of primers</p>
					</caption>
					<table frame="hsides" rules="groups">
						<thead>
							<tr>
								<th align="left">Primers</th>
								<th align="center">Sequences (5&#x2019;-3&#x2019;)</th>
								<th align="center">Product length (<italic>bp</italic>)</th>
							</tr>
						</thead>
						<tbody>
							<tr>
								<td align="left">
									<bold>&#x2003;hTERT-F</bold>
								</td>
								<td align="center">CGGAAGAGTGTCTGGAGCAA</td>
								<td align="center">145</td>
							</tr>
							<tr>
								<td align="left">
									<bold>hTERT-R</bold>
								</td>
								<td align="center">GGATGAAGCGGAGTCTGGA</td>
								<td align="center"/>
							</tr>
							<tr>
								<td align="left">
									<bold>&#x2003;MYC-F</bold>
								</td>
								<td align="center">AAGTCCTGCGCCTCGCAA</td>
								<td align="center">249</td>
							</tr>
							<tr>
								<td align="left">
									<bold>&#x2003;MYC-R</bold>
								</td>
								<td align="center">GCTGTGGCCTCCAGCAGA</td>
								<td align="center"/>
							</tr>
							<tr>
								<td align="left">
									<bold>&#x3B2;-ACTIN-F</bold>
								</td>
								<td align="center">GCTCGTCGTCGACAACGGCT</td>
								<td align="center">353</td>
							</tr>
							<tr>
								<td align="left">
									<bold>&#x3B2;-ACTIN-R</bold>
								</td>
								<td align="center">CAAACATGATCTGGGTCATCTTCTC</td>
								<td align="center"/>
							</tr>
						</tbody>
					</table>
				</table-wrap>
				<p>The PCR conditions were as follows: for hTERT and &#x3B2;-actin 35 cycles of denaturation at 95 &#x00B0;<italic>C</italic> for 30 <italic>sec</italic>, annealing at 59.2 &#x00B0;<italic>C</italic> for 30 <italic>sec</italic> and extension at 72 &#x00B0;<italic>C</italic> for 30 <italic>sec</italic>, respectively.For C-myc &#x3B2; -actin 30 cycles of denaturation at 95 &#x00B0;<italic>C</italic> for 30 <italic>sec</italic> and extension at 72 &#x00B0;<italic>C</italic> for 30 <italic>sec</italic>, respectively. PCR products were loaded on 0.8% agarose gel containing ethidium bromide. The product bands were analysed using gene snap software (Syngene, NJ, USA). The relative intensity was calculated by normalizing with &#x3B2; actin.</p>
			</sec>
		</sec>
		<sec id="S0005" sec-type="results">
			<title>Results</title>
			<p>By MTT assay the percentage of viability was calculated by defining the absorption of cells without lentinan treatment as 100 percent (<xref ref-type="fig" rid="F0002">Figure 2</xref>) at 10 <italic>&#x00B5;l</italic> concentration; also cell viability was observed above 75%.</p>
			<fig id="F0002">
				<label>Figure 2</label>
				<caption>
					<p>MTT ASSAY cell lines were treated with various concentrations of lentinan and cell viability was determined</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-181-g002.tif" alt-version="no"/>
			</fig>
			<p>DLD-1 cells were treated with lentinan at concentration 0,2,4,6,8,10 <italic>ug/ml</italic>. Telomerase activity was examined by TRAP assay. Decreased telomerase level was interpreted by reduction or disappearance of bands (<xref ref-type="fig" rid="F0003">Figure 3</xref>). Telomerase activity was determined by TRAPEZE-ELISA and levels were expressed as% relative activity (<xref ref-type="fig" rid="F0004">Figure 4</xref>).</p>
			<fig id="F0003">
				<label>Figure 3</label>
				<caption>
					<p>Telomerase activity by TRAP assay</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-181-g003.tif" alt-version="no"/>
			</fig>
			<fig id="F0004">
				<label>Figure 4</label>
				<caption>
					<p>Telomerase levels estimation by TRAPEZE-ELISA</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-181-g004.tif" alt-version="no"/>
			</fig>
			<p>DLD-1cells were incubated for 48 <italic>hrs</italic> at lentinan concentrations of 0,2,4,6,8,10 <italic>ug/ml</italic>. Effect on gene expression was examined by RT-PCR (<xref ref-type="fig" rid="F0005">Figures 5</xref> and <xref ref-type="fig" rid="F0006">6</xref>). Percentage of band intensities was calculated with the aid of genesnap software (<xref ref-type="table" rid="T0002">Tables 2</xref> and <xref ref-type="table" rid="T0003">3</xref>). &#x3B2; actin is internal control of gene expression.
</p>
			<fig id="F0005">
				<label>Figure 5</label>
				<caption>
					<p>Effect of lentinan on hTERT gene expression (Lanes 1 through 6 represent 0, 2, 4, 6, 8 and 10 <italic>ug/ml</italic> lentinan concentrations at which DLD-1 gastric cancer cell lines were incubated; M is molecular weight marker)</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-181-g005.tif" alt-version="no"/>
			</fig>
			<fig id="F0006">
				<label>Figure 6</label>
				<caption>
					<p>Effect of lentinan on C-myc gene expression (Lanes 1 through 6 represent 0, 2, 4, 6, 8 and 10 <italic>ug/ml</italic> lentinan concentrations at which DLD-1 gastric cancer cell lines were incubated; M is molecular weight marker)</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-181-g006.tif" alt-version="no"/>
			</fig>
			<table-wrap id="T0002">
			<label>Table 2</label>
				<caption>
					<p>Relative band intensity of hTERT gene expression in DLD-1 cells.Results are the average of three independent experiments (genesnap software)</p>
				</caption>
				<table frame="hsides" rules="groups">
					<thead>
						<tr>
							<th align="left" rowspan="2">Concentration <italic>ug/ml</italic>
							</th>
							<th align="center" colspan="3">% Relative intensity</th>
							<th align="center">Mean&#x00B1;SEM</th>
							<th align="center">p-value</th>
						</tr>
						<tr>
							<th colspan="5" align="center"><hr/></th>
						</tr>
						<tr>
							<th align="left"/>
							<th align="center">
								<bold>1</bold>
							</th>
							<th align="center">
								<bold>2</bold>
							</th>
							<th align="center">
								<bold>3</bold>
							</th>
							<th align="center"/>
							<th align="center"/>
						</tr>
					</thead>
					<tbody>
						<tr>
							<td align="left">
								<bold>0</bold>
							</td>
							<td align="center">100</td>
							<td align="center">100</td>
							<td align="center">100</td>
							<td align="center">100&#x00B1;0.00</td>
							<td align="center"/>
						</tr>
						<tr>
							<td align="left">
								<bold>2</bold>
							</td>
							<td align="center">64.64</td>
							<td align="center">70.37</td>
							<td align="center">96.4</td>
							<td align="center">67.7&#x00B1;3.98</td>
							<td align="center">0.053</td>
						</tr>
						<tr>
							<td align="left">
								<bold>4</bold>
							</td>
							<td align="center">55.39</td>
							<td align="center">54.13</td>
							<td align="center">72.44</td>
							<td align="center">58.80&#x00B1;1.59</td>
							<td align="center">0.005</td>
						</tr>
						<tr>
							<td align="left">
								<bold>6</bold>
							</td>
							<td align="center">54.85</td>
							<td align="center">54.73</td>
							<td align="center">71.65</td>
							<td align="center">51.32&#x00B1;4.43</td>
							<td align="center">0.029</td>
						</tr>
						<tr>
							<td align="left">
								<bold>8</bold>
							</td>
							<td align="center">40.53</td>
							<td align="center">46.01</td>
							<td align="center">50.15</td>
							<td align="center">43.20&#x00B1;4.01</td>
							<td align="center">0.018</td>
						</tr>
						<tr>
							<td align="left">
								<bold>10</bold>
							</td>
							<td align="center">31.49</td>
							<td align="center">37.57</td>
							<td align="center">35.46</td>
							<td align="center">33.27&#x00B1;5.07</td>
							<td align="center">0.020</td>
						</tr>
					</tbody>
				</table>
			</table-wrap>
			<table-wrap id="T0003">
			<label>Table 3</label>
				<caption>
					<p>Relative band intensity of C-myc gene expression in DLD-1 cells. Results are the average of three independent experiments</p>
				</caption>
				<table frame="hsides" rules="groups">
					<thead>
						<tr>
							<th align="left" rowspan="2">Concentration <italic>ug/ml</italic>
							</th>
							<th align="center" colspan="3">% Relative intensity</th>
							<th align="center">Mean&#x00B1;SEM</th>
							<th align="center">p-value</th>
						</tr>
						<tr>
							<th colspan="5" align="center"><hr/></th>
						</tr>
						<tr>
							<th align="left"/>
							<th align="center">
								<bold>1</bold>
							</th>
							<th align="center">
								<bold>2</bold>
							</th>
							<th align="center">
								<bold>3</bold>
							</th>
							<th align="center"/>
							<th align="center"/>
						</tr>
					</thead>
					<tbody>
						<tr>
							<td align="left">
								<bold>0</bold>
							</td>
							<td align="center">100</td>
							<td align="center">100</td>
							<td align="center">100</td>
							<td align="center">100&#x00B1;0.00</td>
							<td align="center"/>
						</tr>
						<tr>
							<td align="left">
								<bold>2</bold>
							</td>
							<td align="center">96.24</td>
							<td align="center">90.43</td>
							<td align="center">73.46</td>
							<td align="center">86.71&#x00B1;6.83</td>
							<td align="center">0.54</td>
						</tr>
						<tr>
							<td align="left">
								<bold>4</bold>
							</td>
							<td align="center">90.15</td>
							<td align="center">77.11</td>
							<td align="center">70.09</td>
							<td align="center">79.12&#x00B1;5.87</td>
							<td align="center">0.23</td>
						</tr>
						<tr>
							<td align="left">
								<bold>6</bold>
							</td>
							<td align="center">71.17</td>
							<td align="center">62.42</td>
							<td align="center">55.68</td>
							<td align="center">63.09&#x00B1;4.48</td>
							<td align="center">0.051</td>
						</tr>
						<tr>
							<td align="left">
								<bold>8</bold>
							</td>
							<td align="center">54.66</td>
							<td align="center">56.44</td>
							<td align="center">24.26</td>
							<td align="center">45.12&#x00B1;10.4</td>
							<td align="center">0.03</td>
						</tr>
						<tr>
							<td align="left">
								<bold>10</bold>
							</td>
							<td align="center">37.14</td>
							<td align="center">34.81</td>
							<td align="center">23.03</td>
							<td align="center">31.66&#x00B1;4.36</td>
							<td align="center">0.010</td>
						</tr>
					</tbody>
				</table>
			</table-wrap>
			<p>To evaluate the mechanism for telomerase inhibition by lentinan we investigated the effect of hTERT expression in DLD 1 cells using RT-PCR technique. For this, we treated DLD-1 cells with lentinan at concentration 0,2,4,6,8,10 <italic>ug/ml</italic> and then examined the telomerase activity by TRAP assay. We observed a decrease in telomerase level by reduction or disappearance of bands (<xref ref-type="fig" rid="F0004">Figure 4</xref>) Percentage of band intensities was calculated with the aid of genesnap software (<xref ref-type="table" rid="T0002">Tables 2</xref> and <xref ref-type="table" rid="T0003">3</xref>) &#x3B2;-actin is internal control of gene expression. Lentinan clearly inhibited the expression of hTERT mRNA in dose dependent manner, indicating that telomerase activity is modulated at the transcriptional level. Since C-myc is a known regulator of hTERT we investigated and confirmed that lentinan reduced the expression levels of C-myc mRNA and hTERT expression (<xref ref-type="fig" rid="F0007">Figure 7</xref>). These observations suggest that lentinan decreases the telomerase activity by down regulating the hTERT expression via C-myc.</p>
			<fig id="F0007">
				<label>Figure 7</label>
				<caption>
					<p>Effect of lentinan on hTERT and C-myc gene expression</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-181-g007.tif" alt-version="no"/>
			</fig>
		</sec>
		<sec id="S0006" sec-type="discussion">
			<title>Discussion</title>
			<p>Since most cancer cells possess telomerase activity, one probable advantage of telomerase targeted therapy would be its specificity on telomerase positive tumour cells, because most human somatic tissues are telomerase negative. On the basis of these observations various types of telomerase inhibitors have been discovered and developed. Such inhibitors include hTR antigens oligonucleotides (2&#x2019;-0-methyl RNA and peptide nucleic acids). (<xref ref-type="bibr" rid="CIT0009">9</xref>) Reverse transcriptase inhibitors (ex: 3&#x2019; azido 3&#x2019; deoxy-thy-midine) (<xref ref-type="bibr" rid="CIT0010">10</xref>) and natural products (ex.telomestatin and sulfoquinovosyldiacyl glycerol) (<xref ref-type="bibr" rid="CIT0011">11</xref>). These inhibitors directly inhibit telomerase activity. Modulators of mRNA expression of telomeral components (i.ehtert) have been regarded as another type of anti telomeral agents. These include all transretonoic acid (<xref ref-type="bibr" rid="CIT0012">12</xref>), 5, 6 &#x2013;trans- 16 -ene-vitamin D3 (<xref ref-type="bibr" rid="CIT0013">13</xref>) ceramide (<xref ref-type="bibr" rid="CIT0014">14</xref>) and curcumin (<xref ref-type="bibr" rid="CIT0015">15</xref>). These compounds act as supressors of hTERT mRNA expression which results in altered telomerase activity.</p>
			<p>According to the previous studies there is a strong correlation between the expression of hTERT mRNA and telomerase activity in extract from culture cells and tissues (<xref ref-type="bibr" rid="CIT0016">16</xref>) Modulators of hTERT expression are regarded as anti-telomeral agents. Our results are especially interesting in demonstrating that lentinan down regulates hTERT expression via C-myc (<xref ref-type="fig" rid="F0008">Figure 8</xref>). In this study, for the first time, we studied the effect of lentinan on hTERT gene expression.</p>
			<fig id="F0008">
				<label>Figure 8</label>
				<caption>
					<p>Graph showing correlation of hTERT expression and C-myc expression in DLD-1 cells after lentinan incubation (genesnap software)</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-181-g008.tif" alt-version="no"/>
			</fig>
		</sec>
		<sec id="S0007" sec-type="conclusion">
			<title>Conclusion</title>
			<p>These studies provide support for role of lentinan as chemopreventative agent against cancer cells. Chemoprevention as a scientific field, may be considered still at its infancy, and includes the use of natural or pharmacological agents to suppress, arrest or reverse carcinogenesis at its early stages. Natural products like genistein, resveratrol, curcumin, retinoic acid and epigallocatechin-3-gallate are proved as chemopreventive agents.</p>
		</sec>
	</body>
	<back>
		<ack>
			<title>Acknowledgement</title>
			<p>Authors are very much thankful to management of KL University, Vijayawada for their encouragement and constant support through-out this research work.</p>
		</ack>
		<ref-list>
			<title>References</title>
			<ref id="CIT0001">
				<label>1</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Morin</surname>
							<given-names>GB</given-names>
						</name>
					</person-group>
					<article-title>The human telomere terminal transferase enzyme is a ribo nucleoprotein that synthesizes TTAGGG repeats</article-title>
					<source>Cell</source>
					<year>1989</year>
					<volume>59</volume>
					<issue>3</issue>
					<fpage>521</fpage>
					<lpage>529</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0002">
				<label>2</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kim</surname>
							<given-names>NW</given-names>
						</name>
						<name>
							<surname>Piatyszek</surname>
							<given-names>MA</given-names>
						</name>
						<name>
							<surname>Prowse</surname>
							<given-names>KR</given-names>
						</name>
						<name>
							<surname>Harley</surname>
							<given-names>CB</given-names>
						</name>
						<name>
							<surname>West</surname>
							<given-names>MD</given-names>
						</name>
						<name>
							<surname>HO</surname>
							<given-names>PLC</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Specific association of human telomerase activity with immortal cells and cancers</article-title>
					<source>Science</source>
					<year>1994</year>
					<volume>266</volume>
					<fpage>2011</fpage>
					<lpage>2015</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0003">
				<label>3</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Nakamura</surname>
							<given-names>TM</given-names>
						</name>
						<name>
							<surname>Morin</surname>
							<given-names>GB</given-names>
						</name>
						<name>
							<surname>Chapman</surname>
							<given-names>KB</given-names>
						</name>
						<name>
							<surname>Weinrich</surname>
							<given-names>SL</given-names>
						</name>
						<name>
							<surname>Andrews</surname>
							<given-names>WH</given-names>
						</name>
						<name>
							<surname>Lingner</surname>
							<given-names>J</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Telomerase catalytic subunit homolgs from fission yeast and human</article-title>
					<source>Science</source>
					<year>1977</year>
					<volume>277</volume>
					<issue>5328</issue>
					<fpage>955</fpage>
					<lpage>959</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0004">
				<label>4</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Wu</surname>
							<given-names>KJ</given-names>
						</name>
						<name>
							<surname>Grandori</surname>
							<given-names>C</given-names>
						</name>
						<name>
							<surname>Amacker</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Simon-Vermot</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Polack</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Lingner</surname>
							<given-names>J</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Direct activation of TERT transcription by C-myc</article-title>
					<source>Nat Genet</source>
					<year>1999</year>
					<volume>21</volume>
					<fpage>220</fpage>
					<lpage>224</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0005">
				<label>5</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Eitsuka</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Nakagawa</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Suzuki</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Miyazawa</surname>
							<given-names>T</given-names>
						</name>
					</person-group>
					<article-title>Polyunsaturated fatty acids inhibit telomerase activity in DLD-1 human colorectal adenocarcinoma cells: a dual mechanism approach</article-title>
					<source>Biochim Biophys Acta</source>
					<year>2005</year>
					<volume>1737</volume>
					<issue>1</issue>
					<fpage>1</fpage>
					<lpage>10</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0006">
				<label>6</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Biray Avc&#x0131;</surname>
							<given-names>C</given-names>
						</name>
						<name>
							<surname>Do&#287;an</surname>
							<given-names>Z</given-names>
						</name>
						<name>
							<surname>Y&#x0131;lmaz</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Numano&#287;lu</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Top&#x00E7;uo&#287;lu</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>G&#x00FC;nd&#x00FC;z</surname>
							<given-names>C</given-names>
						</name>
					</person-group>
					<article-title>Effect of resveratrol and caffeic acid phenethyl ester on the expressions of p53, MDM2, PIK3CA and hTERT in human breast cancer cell line</article-title>
					<source>Adv Mol Med</source>
					<year>2007</year>
					<volume>3</volume>
					<issue>1</issue>
					<fpage>45</fpage>
					<lpage>48</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0007">
				<label>7</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Elliott</surname>
							<given-names>PJ</given-names>
						</name>
						<name>
							<surname>Jirousek</surname>
							<given-names>M</given-names>
						</name>
					</person-group>
					<article-title>Sirtuins: novel targets for metabolic disease</article-title>
					<source>Curr Opin Investig Drugs</source>
					<year>2008</year>
					<volume>9</volume>
					<issue>4</issue>
					<fpage>371</fpage>
					<lpage>378</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0008">
				<label>8</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hideshima</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Chauhan</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Shima</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Raje</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Davies</surname>
							<given-names>FE</given-names>
						</name>
						<name>
							<surname>Tai</surname>
							<given-names>YT</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Thalidomide and its analogs overcome drug resistance of human multiple myeloma cells to conventional therapy</article-title>
					<source>Blood</source>
					<year>2000</year>
					<volume>96</volume>
					<issue>9</issue>
					<fpage>2943</fpage>
					<lpage>2950</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0009">
				<label>9</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pitts</surname>
							<given-names>AE</given-names>
						</name>
						<name>
							<surname>Corey</surname>
							<given-names>DR</given-names>
						</name>
					</person-group>
					<article-title>Inhibition of human telomerase by 2&#x2019;-0&#x2019;-mehyl RNA</article-title>
					<source>Proc Natl Acad Sci USA</source>
					<year>1998</year>
					<volume>95</volume>
					<issue>20</issue>
					<fpage>11549</fpage>
					<lpage>11554</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0010">
				<label>10</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Strahl</surname>
							<given-names>C</given-names>
						</name>
						<name>
							<surname>Blackburn</surname>
							<given-names>EH</given-names>
						</name>
					</person-group>
					<article-title>Effects of reverse transcriptase inhibitors on telomere length and telomerase activity in two immortalized cell lines</article-title>
					<source>Mol Cell Biol</source>
					<year>1996</year>
					<volume>16</volume>
					<issue>1</issue>
					<fpage>53</fpage>
					<lpage>65</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0011">
				<label>11</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Damm</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Hemmann</surname>
							<given-names>U</given-names>
						</name>
						<name>
							<surname>Garin-Chesa</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Hauel</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Kauffmann</surname>
							<given-names>I</given-names>
						</name>
						<name>
							<surname>Priepke</surname>
							<given-names>H</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>A highly selective telomerase inhibitor limiting human cancer cell proliferation</article-title>
					<source>EMBO J</source>
					<year>2001</year>
					<volume>20</volume>
					<issue>24</issue>
					<fpage>6958</fpage>
					<lpage>6968</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0012">
				<label>12</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Meyerson</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Counter</surname>
							<given-names>CM</given-names>
						</name>
						<name>
							<surname>Eaton</surname>
							<given-names>EN</given-names>
						</name>
						<name>
							<surname>Ellisen</surname>
							<given-names>LW</given-names>
						</name>
						<name>
							<surname>Steiner</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Caddle</surname>
							<given-names>SD</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization</article-title>
					<source>Cell</source>
					<year>1997</year>
					<volume>90</volume>
					<issue>4</issue>
					<fpage>785</fpage>
					<lpage>795</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0013">
				<label>13</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hisatake</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Kubota</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Hisatake</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Uskokovic</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Tomoyasu</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Koeffler</surname>
							<given-names>HP</given-names>
						</name>
					</person-group>
					<article-title>5,6-trans -16-ene-Vita-min D<sub>3</sub>: a new class of potent inhibitors of proliferation of prostate, breast, and myeloid leukemic cells</article-title>
					<source>Cancer Res</source>
					<year>1999</year>
					<volume>59</volume>
					<issue>16</issue>
					<fpage>4023</fpage>
					<lpage>4029</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0014">
				<label>14</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ogretmen</surname>
							<given-names>B</given-names>
						</name>
						<name>
							<surname>Kraveka</surname>
							<given-names>JM</given-names>
						</name>
						<name>
							<surname>Schandy</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Usta</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Hannum</surname>
							<given-names>YA</given-names>
						</name>
						<name>
							<surname>Obeid</surname>
							<given-names>LM</given-names>
						</name>
					</person-group>
					<article-title>Molecular mechanisms of ceramide-mediated telomerase inhibition in the A249 human lung adenocarcinoma cell line</article-title>
					<source>J Biol Chem</source>
					<year>2001</year>
					<volume>276</volume>
					<issue>35</issue>
					<fpage>32506</fpage>
					<lpage>32514</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0015">
				<label>15</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Ramachandran</surname>
							<given-names>C</given-names>
						</name>
						<name>
							<surname>Fonseca</surname>
							<given-names>HB</given-names>
						</name>
						<name>
							<surname>Jhabvala</surname>
							<given-names>P</given-names>
						</name>
						<name>
							<surname>Escalon</surname>
							<given-names>EA</given-names>
						</name>
						<name>
							<surname>Melnick</surname>
							<given-names>SJ</given-names>
						</name>
					</person-group>
					<article-title>Curcumin inhibits telomerase activity through human telomerase reverse transcriptase in MCF-7 breast cancer cell line</article-title>
					<source>Cancer Lett</source>
					<year>2002</year>
					<volume>184</volume>
					<issue>1</issue>
					<fpage>1</fpage>
					<lpage>6</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0016">
				<label>16</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Takakura</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Kyo</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Kanaya</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Tanaka</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Inoue</surname>
							<given-names>M</given-names>
						</name>
					</person-group>
					<article-title>Expression of human telomerase subunits and correlation with telomerase activity in cervical cancer</article-title>
					<source>Cancer Res</source>
					<year>1998</year>
					<volume>58</volume>
					<issue>7</issue>
					<fpage>1558</fpage>
					<lpage>1561</lpage>
				</nlm-citation>
			</ref>
		</ref-list>
	</back>
</article>
