<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" article-type="research-article" xml:lang="en">
	<front>
		<journal-meta>
			<journal-id journal-id-type="publisher-id">AJMB</journal-id>
			<journal-title>Avicenna Journal of Medical Biotechnology</journal-title>
			<issn pub-type="ppub">2008-2835</issn>
			<issn pub-type="epub">2008-4625</issn>
			<publisher>
				<publisher-name>Avicenna Research Institute</publisher-name>
			</publisher>
		</journal-meta>
		<article-meta>
			<article-id pub-id-type="publisher-id">AJMB-2-131</article-id>
			<article-categories>
				<subj-group subj-group-type="heading">
					<subject>Original Article</subject>
				</subj-group>
			</article-categories>
			<title-group>
				<article-title>Human Tissue Plasminogen Activator Expression in <italic>Escherichia coli</italic> using Cytoplasmic and Periplasmic Cumulative Power</article-title>
			</title-group>
			<contrib-group>
				<contrib contrib-type="author">
					<name>
						<surname>Majidzadeh-A</surname>
						<given-names>Keivan</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
					<xref ref-type="aff" rid="AF0002">2</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Mahboudi</surname>
						<given-names>Fereidoun</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Hemayatkar</surname>
						<given-names>Mahdi</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Davami</surname>
						<given-names>Fatemeh</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Barkhordary</surname>
						<given-names>Farzaneh</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Adeli</surname>
						<given-names>Ahmad</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Soleimani</surname>
						<given-names>Mohammad</given-names>
					</name>
					<xref ref-type="aff" rid="AF0003">3</xref>
				</contrib>
				<contrib contrib-type="author">
					<name>
						<surname>Davoudi</surname>
						<given-names>Noushin</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
				</contrib>
				<contrib contrib-type="author" corresp="yes">
					<name>
						<surname>Khalaj</surname>
						<given-names>Vahid</given-names>
					</name>
					<xref ref-type="aff" rid="AF0001">1</xref>
					<xref ref-type="corresp" rid="cor1">&#x002A;</xref>
				</contrib>
			</contrib-group>
			<aff id="AF0001">
				<label>1</label>Biotechnology Department, Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran</aff>
			<aff id="AF0002">
				<label>2</label>Iranian Center for Breast Cancer (ICBC), ACECR, Tehran, Iran</aff>
			<aff id="AF0003">
				<label>3</label>Azad University, Qom, Iran</aff>
			<author-notes>
				<corresp id="cor1">
				<label>&#x002A;</label>
					<bold>Corresponding author:</bold> Vahid Khalaj, Ph.D., Biotechnology Department, Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran. <bold>Tel:</bold> +98 21 66480780. <bold>Fax:</bold> +98 21 66480780. <bold>E-mail:</bold> <email xlink:href="khalajs@pasteur.ac.ir">khalajs@pasteur.ac.ir</email>
				</corresp>
			</author-notes>
			<pub-date pub-type="ppub">
				<season>July-September</season>
				<year>2010</year>
			</pub-date>
			<volume>2</volume>
			<issue>3</issue>
			<fpage>131</fpage>
			<lpage>136</lpage>
			<history>
				<date date-type="received">
					<day>05</day>
					<month>07</month>
					<year>2010</year>
				</date>
				<date date-type="accepted">
					<day>04</day>
					<month>08</month>
					<year>2010</year>
				</date>
			</history>
			<permissions>
				<copyright-statement>Copyright &#x00A9; 2010 Avicenna Research Institute</copyright-statement>
				<copyright-year>2010</copyright-year>
				<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">
					<p>This work is licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly.</p>
				</license>
			</permissions>
			<abstract>
					<p>Tissue plasminogen activator (tPA) is a serine protease, which is composed of five distinct structural domains with 17 disulfide bonds, representing a model of high-disulfide proteins in human body. One of the most important limitations for high yield heterologous protein production in <italic>Escherichia coli</italic> (<italic>E. coli)</italic> is the expression of complex proteins with multiple disulfide bridges. In this study the combination of two distinct strategies, manipulated cytoplasm and native periplasm, was applied to produce the functional full length tPA enzyme in <italic>E. coli</italic>. Using a PelB signal peptide sequence at 5&#x2032; site of tPA gene, the expression cassette was prepared and subsequently was transformed into a strain with manipulated oxidizing cytoplasm. Then the induction was made to express the protein of interest. The SDS-PAGE analysis and gelatin hydrolysis confirmed the successful expression of functional tPA. The results of this study showed that complex proteins can be produced in <italic>E. coli</italic> using the cumulative power of both cytoplasm and periplasm.</p>
			</abstract>
			<kwd-group>
				<kwd>Cytoplasm</kwd>
				<kwd>
					<italic>Escherichia coli</italic>
				</kwd>
				<kwd>Periplasm</kwd>
				<kwd>Proteins</kwd>
				<kwd>Tissue Plasminogen Activator</kwd>
			</kwd-group>
		</article-meta>
	</front>
	<body>
		<sec id="S0001" sec-type="intro">
			<title>Introduction</title>
			<p>Tissue plasminogen activator (tPA) is a &#x223C;64 <italic>kDa</italic> serine protease that converts the plasminogen to plasmin, a serine protease of broad specificity that degrades the fibrin network in thrombi. tPA is composed of five distinct structural domains; a finger region, an epidermal growth factor-like sub-domain, two kringle domains, and finally, the catalytic domain. It is a 527-amino acid protein, with 35 cysteine residues that participate in formation of 17 disulfide bonds, representing a model of high-disulfide proteins in human body (<xref ref-type="bibr" rid="CIT0001">1</xref>, <xref ref-type="bibr" rid="CIT0002">2</xref>).</p>
			<p>Prokaryotic systems such as <italic>E.coli</italic> have been the most widely used systems for the recombinant protein production. This is mainly due to genetic simplicity, fast growth rate, high cell density production and the availability of an increasingly large number of vectors and host strains (<xref ref-type="bibr" rid="CIT0003">3</xref>&#x2013;<xref ref-type="bibr" rid="CIT0005">5</xref>). One of the most important limitations for high yield heterologous protein production in <italic>E. coli</italic> is the expression of complex proteins with multiple disulfide bridges. Among the several factors affecting the efficiency of such complex proteins production (<xref ref-type="bibr" rid="CIT0006">6</xref>&#x2013;<xref ref-type="bibr" rid="CIT0009">9</xref>), the reducing environment of cytoplasm seems to play a key role in improper folding of such high disulfide bonded proteins. The periplasm of <italic>E.coli</italic> is more oxidizing environment and in wild type bacteria is more suitable than cytoplasm for proper folding (<xref ref-type="bibr" rid="CIT0003">3</xref>).</p>
			<p>There are two common <italic>in vivo</italic> approaches to improve the conformation of complex proteins in <italic>E. coli</italic>. The first is manipulating the condition of cytoplasm by converting its reducing nature into an oxidizing environment. In this approach the gene of interest, without the signal peptide encoding sequence is transformed into the engineered <italic>E. coli</italic> strain (<xref ref-type="bibr" rid="CIT0010">10</xref>). As a result, the recombinant protein maintains in oxidizing environment of cytoplasm and the proper conformation of the protein forms.</p>
			<p>In the second approach, the secretion of the protein into the less reducing environment of periplasm is the main idea. To achieve this goal, the gene of interest containing a suitable signal peptide is introduced to the bacterial host and the signal peptide directs the protein into the periplasm.</p>
			<p>The aim of this study was to investigate the potential of using a signal peptide for production of a highly disulfide bonded protein in an <italic>E. coli</italic> strain with engineered cytoplasm. So, for the first time, we have used both approaches by a simple method that can be improved in future studies. Using a signal peptide sequence at 5&#x2019; site of tPA gene, the expression cassette was prepared and subsequently was transformed into a strain with manipulated oxidizing cytoplasm. In this way the protein of interest is produced in oxidizing environment of cytoplasm and the disulfide bonds would be formed to some extent. Then signal peptide transfers the produced protein into the periplasm where a greater amount of the disulfide bonds would be formed in less reducing environment of periplasm.</p>
			<p>In this introductory study, tPA was cloned and expressed in an <italic>E.coli</italic> strain with oxidizing specialty. The expression and function of tPA were assayed by SDS-PAGE and Gelatin Hydrolysis test.</p>
		</sec>
		<sec id="S0002" sec-type="materials|methods">
			<title>Materials and Methods</title>
			<sec id="S20003">
				<title>Strains, plasmids and culture media</title>
				<p>
					<italic>Escherichia coli</italic> strain Top10 F&#x2032; was used as the host for recombinant plasmid. Origami B (DE3) was used as expression host. pTZ57R (Fermentas, Vinius, Lithuania) as T/A cloning vector and pET22b as expression vector were used in experiments. pET22b is a bacterial vector with the size of 5.5 <italic>kb</italic> and contains PelB sequence for periplasmic localization. LB agar and Broth were used for culturing the strains.</p>
			</sec>
			<sec id="S20004">
				<title>PCR amplification and cloning of human tPA gene</title>
				<p>Genomic DNA of CHO 1&#x2013;15 cell line (ATCC- CRL 9606) transfected by full length cDNA of human tPA (GenBank accession number 101047), was used as template for PCR amplification. FortPA (5&#x2032;-AACCATGG ATGCAATGAAGAGAGGGCTC -3&#x2032;) containing <italic>Not</italic>I restriction site and RevtPA (5&#x2032;- GCGGCCGCTCACGGTCGCATGTTG -3&#x2032;) containing <italic>Nco</italic>I restriction site were used as forward and reverse primers, respectively. A high fidelity PCR reaction was set with following thermal cycles: 2 <italic>min</italic> at 95 <italic>&#x00B0;C</italic> for one cycle, and 30 cycles of 1 <italic>min</italic> at 95 &#x00B0;<italic>C</italic>, 45 <italic>sec</italic> at 68 &#x00B0;<italic>C</italic>, 2 <italic>min</italic> at 72 &#x00B0;<italic>C</italic>, and a final extension cycle of 10 <italic>min</italic> at 72 &#x00B0;<italic>C</italic>.</p>
				<p>The resulting PCR product was tailed by an oligo A at 3&#x2032; side and subsequently was cloned into the pTZ57R vector (Fermentas, Vinius, Lithuania), generating pTZ-tPA. Restriction mapping and bidirectional sequencing of cloned fragment was performed to confirm the construct. To prepare the final construct, tPA cloned fragment was cut from pTZ-tPA vector using <italic>Not</italic>I and <italic>Nco</italic>I enzymes and subsequently cloned into pET22b. The final construct was called pET/ tPA and confirmed by restriction analysis and sequencing.</p>
			</sec>
			<sec id="S20005">
				<title>Transformation of origami B (DE3) cells and expression of recombinant tPA</title>
				<p>Competent cell preparation and transformation was done using standard Calcium chloride method. The transformed cells were cultured in LB Agar containing Tetracycline. For expression experiments, transformants were cultured in 5 <italic>ml</italic> LB broth and the induction was carried out by adding IPTG 1<italic>M</italic> at the optical density of 0.3&#x2013;0.5 in 600 <italic>nm</italic>.</p>
			</sec>
			<sec id="S20006">
				<title>SDS-PAGE analysis and zymography test</title>
				<p>Cell lysis and SDS-PAGE analysis on 12% polyacrylamide gels were performed according to standard methods (<xref ref-type="bibr" rid="CIT0011">11</xref>).</p>
				<p>Zymography test was performed as described before (<xref ref-type="bibr" rid="CIT0012">12</xref>, <xref ref-type="bibr" rid="CIT0013">13</xref>). Briefly, the protein samples were separated on a 11% non-reducing SDS-poly acrylamide gel containing appropriate amount of Plasminogen (Chromogenix, Italy) and Gelatin (Sigma, USA). After complete separation, the gel was soaked in 2.5% (w/v) Triton X-100 at room temperature for 1 <italic>hr</italic> to remove SDS and then incubated in 0.1 <italic>M</italic> glycine/ NaOH (pH= 8.3) for 5 <italic>hr</italic> at 37 <italic>&#x00B0;C</italic>. The gel (zymogram) was subsequently stained with Coomassie Brilliant Blue and the areas of digestion appeared as clear bands against a darkly stained background where the substrate has been degraded by the enzyme.</p>
			</sec>
		</sec>
		<sec id="S0007" sec-type="results">
			<title>Results</title>
			<p>Amplification and cloning of tPA cDNA</p>
			<p>Human tPA cDNA was amplified by specific primers (<xref ref-type="fig" rid="F0001">Figure 1</xref>) and the resulting fragment was cloned into pTZ57R; successfully. <xref ref-type="fig" rid="F0002">Figure 2</xref>, lane 1 shows the result of restriction digestion of pTZ/ tPA by <italic>Not</italic>I and <italic>Nco</italic>I enzymes which created two fragments; the backbone of cloning vector (2.9 <italic>kb</italic>) and tPA fragment.</p>
			<fig id="F0001">
				<label>Figure 1</label>
				<caption>
					<p>Amplification of tPA cDNA using genomic DNA of CHO 1&#x2013;15 cell line. A specific band of &#x223C;1.7 <italic>kb</italic> was amplified (lane 1). Lane 2: size marker</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-131-g001.tif" alt-version="no"/>
			</fig>
			<fig id="F0002">
				<label>Figure 2</label>
				<caption>
					<p>Restriction analysis of pTZ/tPA construct. Lane 1) Size marker. Lane 2) Fragments created by <italic>Nco</italic>I/<italic>Not</italic>I digestion of the construct; The backbone plasmid (2.9 <italic>kb</italic>) and tPA fragment (1.7 <italic>kb</italic>) are present. Lane 4) <italic>Nco</italic>I/<italic>Not</italic>I linearized pET22b plasmid. Lanes 3 and 5 represent undigested plasmids</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-131-g002.tif" alt-version="no"/>
			</fig>
			<p>The size of expression construct (pET/tPA) was 7.2 <italic>kb</italic> and the restriction map of this construct using <italic>Not</italic>I and <italic>Nco</italic>I enzymes showed two fragments with expected sizes at 5.5 <italic>kb</italic> and 1.7 <italic>kb</italic>, confirming a successful sub-cloning of tPA gene into pET22b expression vector (<xref ref-type="fig" rid="F0003">Figure 3</xref>). Final sequencing of the construct confirmed the presence and correct orientation of insert inside the vector (data not shown).</p>
			<fig id="F0003">
				<label>Figure 3</label>
				<caption>
					<p>Restriction analysis of pET/tPA construct. Lane 2 shows two fragments created by NcoI/NotI digestion. The back bone plasmid, pET22b vector (5.5 <italic>kb</italic>), and tPA fragment (1.7 <italic>kb</italic>) are present. Lane 3 shows the undigested plasmid. Lane 1: Size marker</p>
				</caption>
				<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-131-g003.tif" alt-version="no"/>
			</fig>
			<sec id="S20008">
				<title>Expression of recombinant tPA</title>
				<p>Expression of recombinant tPA was induced by addition of IPTG as described above. A positive transformant was selected and was grown in LB medium until the cell optical density (OD, 600 <italic>nm</italic>) reached to 0.3&#x2013;0.5.</p>
				<p>Following induction, four hour- samples were taken and the lysates of induced and non-induced cells were compared in a standard SDS-Polyacrylamide gel (<xref ref-type="fig" rid="F0004">Figure 4</xref>). In <xref ref-type="fig" rid="F0004">Figure 4</xref>, lanes 2 and 4 represent the expressed band of tPA in cell lysate of recombinant Origami B (DE3) after four <italic>hr</italic> of induction (arrows).The band related to t-PA protein expressed by Origami B (DE3) transformant is shown by the arrow. Lanes 1 and 3 show the protein background of expression host before induction. The lack of expression in columns 1 and 3 shows a tight regulation of expression in pET22b vector. Lane 5 represents the molecular weight marker bands.</p>
				<fig id="F0004">
					<label>Figure 4</label>
					<caption>
						<p>SDS-PAGE analysis of a recombinant clone producing tPA. Lanes 1 and 3 show the protein back ground of expression host before induction. Lanes 2 and 4 represent the expressed band of t-PA in cell lysate of recombinant Origami B (DE3) after four hours of induction. Arrows indicate the bands related to recombinant tPA</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-131-g004.tif" alt-version="no"/>
				</fig>
			</sec>
			<sec id="S20009">
				<title>Gelatin hydrolysis test</title>
				<p>In Zymography test, the plasminogen and gelatin were co-polymerized and immobilized with a non-reducing polyacrylamide gel. The cell lysate of transformed expression host before and after induction were applied to evaluate the activity and conformation of recombinant tPA (<xref ref-type="fig" rid="F0005">Figure 5</xref>). The transparent regions on the gel, which was observed only in transformed host (Lane 7 of <xref ref-type="fig" rid="F0005">Figure 5</xref>), indicated that the plasminogen is digested by serine-protease activity of t-PA and the derived plasmin resulted in gelatin hydrolysis. Commercial t-PA (Actylase) was used as positive control (Lane 6 of <xref ref-type="fig" rid="F0005">Figure 5</xref>). Cell lysate of transformed expression host before induction was used as negative control (Lanes 1&#x2013;5 of <xref ref-type="fig" rid="F0005">Figure 5</xref>).</p>
				<fig id="F0005">
					<label>Figure 5</label>
					<caption>
						<p>The cell lysate of transformed expression host before and after induction were applied to evaluate the activity and conformation of recombinant t-PA. Lane 7 shows the transparent band of cell lysate after induction, which indicated that the plasminogen is digested by serine-protease activity of t-PA and derived plasmin resulted in gelatin hydrolysis. Commercial t-PA (Actylase) was used as positive control (Lanes 6). Cell lysate of transformed expression host before induction (Lane 5) and negative colonies (Lanes1-4) after induction were used as negative controls</p>
					</caption>
					<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-2-131-g005.tif" alt-version="no"/>
				</fig>
			</sec>
		</sec>
		<sec id="S0010" sec-type="discussion">
			<title>Discussion</title>
			<p>Tissue plasminogen activator is an important enzyme for biotechnology industry due to its extended application in medicine (<xref ref-type="bibr" rid="CIT0014">14</xref>&#x2013;<xref ref-type="bibr" rid="CIT0016">16</xref>). It is one of the most complex proteins in human body and currently is produced in CHO which is a mammalian host and so the production cost is very high (<xref ref-type="bibr" rid="CIT0001">1</xref>). Attempts to produce active tPA in <italic>Saccharomyces cerevisiae</italic> or in insect cells have been frustrated by problems like hyperglycosylation, poor export, and improper folding (<xref ref-type="bibr" rid="CIT0017">17</xref>&#x2013;<xref ref-type="bibr" rid="CIT0019">19</xref>).</p>
			<p>Due to its high growth rate, easy handling, low cost, and the availability of variety of strains and vectors, <italic>E. coli</italic> is a suitable host for recombinant production of target proteins.</p>
			<p>In native strains of <italic>E. coli</italic> the condition of periplasm is more suitable for the expression of highly disulfide bonded proteins than cytoplasm of the cells. Although disulfide bond formation usually takes place in periplasmic space, tPA secreted in the periplasm of <italic>E. coli</italic> was misfolded and completely inactive in its primary trials (<xref ref-type="bibr" rid="CIT0020">20</xref>).</p>
			<p>The <italic>E. coli</italic> cytoplasm contains two thioredoxins, TrxA and TrxC, and three glutaredoxins. The oxidized form of these proteins can catalyze the formation of disulfide bonds in target peptides. In the cytosol, both the thioredoxins and the glutaredoxins are maintained in a reduced state by the action of thioredoxin reductase (TrxB) and glutathione, respectively (<xref ref-type="bibr" rid="CIT0021">21</xref>).</p>
			<p>In a trxB null mutant, some disulfide bonded proteins such as alkaline phosphatase were expressed with proper folding and function (<xref ref-type="bibr" rid="CIT0013">13</xref>). The expression of disulfide bonded proteins was found to be even more efficient in double mutants defective cells in both thioredoxin (trxB) and glutathione (gor or gshA) pathways (<xref ref-type="bibr" rid="CIT0022">22</xref>, <xref ref-type="bibr" rid="CIT0023">23</xref>).</p>
			<p>In this study we used Origami B (DE3) cell, in which the cytoplasm is engineered through a double mutation in both thioredoxin and glutathione genes. Unlike the other reports, we have used an expression vector carrying a signal sequence. We hypothesized that the disulfide bond formation will partly take place during protein synthesis in suitable environment of origami B cytoplasm and, the remaining portion of disulfide bonds would be formed by directing tPA molecules into the periplasmic space through signal peptide.</p>
			<p>Gelatin hydrolysis test is a functional assay to show hydrolytic activity of the test protein. Using this assay, we showed that the expressed tPA is active.</p>
		</sec>
		<sec id="S0011" sec-type="conclusion">
			<title>Conclusion</title>
			<p>Recombinant expression of a highly disulfide bonded protein, human t-PA, in <italic>E. coli</italic> was investigated in this study. As the functionality of t-PA is highly dependent on its proper folding and disulfide bond formation, it can be concluded that the application of two distinct strategies, manipulated cytoplasm and native periplasm would be an effective approach in recombinant production of complex proteins.</p>
		</sec>
	</body>
	<back>
		<ack>
			<title>Acknowledgement</title>
			<p>The authors would like to thank Dr. Behrouz Vaziri for his valuable comments. This work is financially supported by Pasteur Institute of Iran.</p>
		</ack>
		<ref-list>
			<title>References</title>
			<ref id="CIT0001">
				<label>1</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Pennica</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Holmes</surname>
							<given-names>WE</given-names>
						</name>
						<name>
							<surname>Kohr</surname>
							<given-names>WJ</given-names>
						</name>
						<name>
							<surname>Harkins</surname>
							<given-names>RN</given-names>
						</name>
						<name>
							<surname>Vehar</surname>
							<given-names>GA</given-names>
						</name>
						<name>
							<surname>Ward</surname>
							<given-names>CA</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Cloning and expression of human tissue-type plasminogen activator cDNA in E. coli</article-title>
					<source>Nature</source>
					<year>1983</year>
					<volume>301</volume>
					<issue>5897</issue>
					<fpage>214</fpage>
					<lpage>221</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0002">
				<label>2</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>van Zonneveld</surname>
							<given-names>AJ</given-names>
						</name>
						<name>
							<surname>Veermanet</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>MacDonald</surname>
							<given-names>ME</given-names>
						</name>
						<name>
							<surname>Pannekoek</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>van Mourik</surname>
							<given-names>JA</given-names>
						</name>
					</person-group>
					<article-title>Structure and function of human tissue-type plasminogen activator (t-PA)</article-title>
					<source>J Cell Biochem</source>
					<year>1986</year>
					<volume>32</volume>
					<issue>3</issue>
					<fpage>169</fpage>
					<lpage>178</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0003">
				<label>3</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Gasser</surname>
							<given-names>B</given-names>
						</name>
						<name>
							<surname>Saloheimo</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Rinas</surname>
							<given-names>U</given-names>
						</name>
						<name>
							<surname>Dragosits</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Carmona</surname>
							<given-names>ER</given-names>
						</name>
						<name>
							<surname>Baumann</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Giuliani</surname>
							<given-names>M</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Protein folding and conformational stress in microbial cells producing recombinant protein: a host comparative overview</article-title>
					<source>Microb Cell Fact</source>
					<year>2008</year>
					<volume>7</volume>
					<fpage>11</fpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0004">
				<label>4</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Verma</surname>
							<given-names>R</given-names>
						</name>
						<name>
							<surname>Boleti</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>George</surname>
							<given-names>AJT</given-names>
						</name>
					</person-group>
					<article-title>Antibody engineering: comparison of bacterial, yeast, insect and mammalian expression systems</article-title>
					<source>J Immunol Methods</source>
					<year>1998</year>
					<volume>216</volume>
					<issue>1-2</issue>
					<fpage>165</fpage>
					<lpage>181</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0005">
				<label>5</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Baneyx</surname>
							<given-names>F</given-names>
						</name>
					</person-group>
					<article-title>Recombinant protein expression in Escherichia coli</article-title>
					<source>Curr Opin Biotechnol</source>
					<year>1999</year>
					<volume>10</volume>
					<issue>5</issue>
					<fpage>411</fpage>
					<lpage>421</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0006">
				<label>6</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Bardwell</surname>
							<given-names>JC</given-names>
						</name>
						<name>
							<surname>McGovern</surname>
							<given-names>K</given-names>
						</name>
						<name>
							<surname>Beckwith</surname>
							<given-names>J</given-names>
						</name>
					</person-group>
					<article-title>Identification of a protein required for disulfide bond formation in vivo</article-title>
					<source>Cell</source>
					<year>1991</year>
					<volume>67</volume>
					<issue>3</issue>
					<fpage>581</fpage>
					<lpage>589</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0007">
				<label>7</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Kamitani</surname>
							<given-names>S</given-names>
						</name>
						<name>
							<surname>Akiyama</surname>
							<given-names>Y</given-names>
						</name>
						<name>
							<surname>Ito</surname>
							<given-names>K</given-names>
						</name>
					</person-group>
					<article-title>Identification and characterization of an Escherichia coli gene required for the formation of correctly folded alkaline phosphatase, a periplasmic enzyme</article-title>
					<source>EMBO J</source>
					<year>1992</year>
					<volume>11</volume>
					<issue>1</issue>
					<fpage>57</fpage>
					<lpage>62</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0008">
				<label>8</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Peek</surname>
							<given-names>JA</given-names>
						</name>
						<name>
							<surname>Taylor</surname>
							<given-names>RK</given-names>
						</name>
					</person-group>
					<article-title>Characterization of a periplasmic thiol: disulfide interchange protein required for the functional maturation of secreted virulence factors of Vibrio cholerae</article-title>
					<source>Proc Natl Acad Sci USA</source>
					<year>1992</year>
					<volume>89</volume>
					<issue>13</issue>
					<fpage>6210</fpage>
					<lpage>6214</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0009">
				<label>9</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Hua</surname>
							<given-names>Q</given-names>
						</name>
						<name>
							<surname>Yang</surname>
							<given-names>C</given-names>
						</name>
						<name>
							<surname>Oshima</surname>
							<given-names>T</given-names>
						</name>
						<name>
							<surname>Mori</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Shimizu</surname>
							<given-names>K</given-names>
						</name>
					</person-group>
					<article-title>Analysis of gene expression in Escherichia coli in response to changes of growth-limiting nutrient in chemostat cultures</article-title>
					<source>Appl Environ Microbiol</source>
					<year>2004</year>
					<volume>70</volume>
					<issue>4</issue>
					<fpage>2354</fpage>
					<lpage>2366</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0010">
				<label>10</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Mattes</surname>
							<given-names>R</given-names>
						</name>
					</person-group>
					<article-title>The production of improved tissue-type plasminogen activator in Escherichia coli</article-title>
					<source>Semin Thromb Hemost</source>
					<year>2001</year>
					<volume>27</volume>
					<issue>4</issue>
					<fpage>325</fpage>
					<lpage>336</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0011">
				<label>11</label>
				<nlm-citation citation-type="book">
					<person-group person-group-type="author">
						<name>
							<surname>Ausubel</surname>
							<given-names>FM</given-names>
						</name>
					</person-group>
					<source>Current protocols in molecular biology</source>
					<year>1987</year>
					<publisher-loc>New York</publisher-loc>
					<publisher-name>John Wiley &#x0026; Sons</publisher-name>
				</nlm-citation>
			</ref>
			<ref id="CIT0012">
				<label>12</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Snoek-van Beurden</surname>
							<given-names>PA</given-names>
						</name>
						<name>
							<surname>Von den Hoff</surname>
							<given-names>JW</given-names>
						</name>
					</person-group>
					<article-title>Zymographic techniques for the analysis of matrix metalloproteinases and their inhibitors</article-title>
					<source>Biotechniques</source>
					<year>2005</year>
					<volume>38</volume>
					<issue>1</issue>
					<fpage>73</fpage>
					<lpage>83</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0013">
				<label>13</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Soleimani</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Mahboudi</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Davoudi</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Amanzadeh</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Azizi</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Adeli</surname>
							<given-names>A</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Expression of human tissue plasminogen activator in the trypanosomatid protozoan Leishmania tarentolae</article-title>
					<source>Biotechnol Appl Biochem</source>
					<year>2007</year>
					<volume>48</volume>
					<issue>Pt 1</issue>
					<fpage>55</fpage>
					<lpage>61</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0014">
				<label>14</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Bergmann</surname>
							<given-names>SR</given-names>
						</name>
						<name>
							<surname>Fox</surname>
							<given-names>KA</given-names>
						</name>
						<name>
							<surname>Ter-Pogossian</surname>
							<given-names>MM</given-names>
						</name>
						<name>
							<surname>Sobel</surname>
							<given-names>BE</given-names>
						</name>
						<name>
							<surname>Collen</surname>
							<given-names>D</given-names>
						</name>
					</person-group>
					<article-title>Clot-selective coronary thrombolysis with tissue-type plasminogen activator</article-title>
					<source>Science</source>
					<year>1983</year>
					<volume>220</volume>
					<issue>4602</issue>
					<fpage>1181</fpage>
					<lpage>1183</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0015">
				<label>15</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Van de Werf</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Bergmann</surname>
							<given-names>SR</given-names>
						</name>
						<name>
							<surname>Fox</surname>
							<given-names>KA</given-names>
						</name>
						<name>
							<surname>de Geest</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Hoyng</surname>
							<given-names>CF</given-names>
						</name>
						<name>
							<surname>Sobel</surname>
							<given-names>BE</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Coronary thrombolysis with intravenously administered human tissue-type plasminogen activator produced by recombinant DNA technology</article-title>
					<source>Circulation</source>
					<year>1984</year>
					<volume>69</volume>
					<issue>3</issue>
					<fpage>605</fpage>
					<lpage>610</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0016">
				<label>16</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Van de Werf</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Ludbrook</surname>
							<given-names>PA</given-names>
						</name>
						<name>
							<surname>Bergmann</surname>
							<given-names>SR</given-names>
						</name>
						<name>
							<surname>Tiefenbrunn</surname>
							<given-names>AJ</given-names>
						</name>
						<name>
							<surname>Fox</surname>
							<given-names>KAA</given-names>
						</name>
						<name>
							<surname>de Geest</surname>
							<given-names>H</given-names>
						</name>
						<etal/>
					</person-group>
					<article-title>Coronary thrombolysis with tissue-type plasminogen activator in patients with evolving myocardial infarction</article-title>
					<source>N Engl J Med</source>
					<year>1984</year>
					<volume>310</volume>
					<issue>10</issue>
					<fpage>609</fpage>
					<lpage>613</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0017">
				<label>17</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Martegani</surname>
							<given-names>E</given-names>
						</name>
						<name>
							<surname>Forlani</surname>
							<given-names>N</given-names>
						</name>
						<name>
							<surname>Mauri</surname>
							<given-names>I</given-names>
						</name>
						<name>
							<surname>Porro</surname>
							<given-names>D</given-names>
						</name>
						<name>
							<surname>Schleuning</surname>
							<given-names>WD</given-names>
						</name>
						<name>
							<surname>Alberghina</surname>
							<given-names>L</given-names>
						</name>
					</person-group>
					<article-title>Expression of high levels of human tissue plasminogen activator in yeast under the control of an inducible GAL promoter</article-title>
					<source>Appl Microbiol Biotechnol</source>
					<year>1992</year>
					<volume>37</volume>
					<issue>5</issue>
					<fpage>604</fpage>
					<lpage>608</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0018">
				<label>18</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Furlong</surname>
							<given-names>AM</given-names>
						</name>
						<name>
							<surname>Thomsen</surname>
							<given-names>DR</given-names>
						</name>
						<name>
							<surname>Marotti</surname>
							<given-names>KR</given-names>
						</name>
						<name>
							<surname>Post</surname>
							<given-names>LE</given-names>
						</name>
						<name>
							<surname>Sharma</surname>
							<given-names>SK</given-names>
						</name>
					</person-group>
					<article-title>Active human tissue plasminogen activator secreted from insect cells using a baculo-virus vector</article-title>
					<source>Biotechnol Appl Biochem</source>
					<year>1988</year>
					<volume>10</volume>
					<issue>5</issue>
					<fpage>454</fpage>
					<lpage>464</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0019">
				<label>19</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Steiner</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Pohl</surname>
							<given-names>G</given-names>
						</name>
						<name>
							<surname>Gunne</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Hellers</surname>
							<given-names>M</given-names>
						</name>
						<name>
							<surname>Elhammer</surname>
							<given-names>A</given-names>
						</name>
						<name>
							<surname>Hansson</surname>
							<given-names>L</given-names>
						</name>
					</person-group>
					<article-title>Human tissue-type plasminogen activator synthesized by using a baculovirus vector in insect cells compared with human plasminogen activator produced in mouse cells</article-title>
					<source>Gene</source>
					<year>1988</year>
					<volume>73</volume>
					<issue>2</issue>
					<fpage>449</fpage>
					<lpage>457</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0020">
				<label>20</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Nakamoto</surname>
							<given-names>H</given-names>
						</name>
						<name>
							<surname>Bardwell</surname>
							<given-names>JC</given-names>
						</name>
					</person-group>
					<article-title>Catalysis of disulfide bond formation and isomerization in the Escherichia coli periplasm</article-title>
					<source>Biochim et Biophysica Acta</source>
					<year>2004</year>
					<volume>1694</volume>
					<issue>1&#x2013;3</issue>
					<fpage>111</fpage>
					<lpage>119</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0021">
				<label>21</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Aslund</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Beckwith</surname>
							<given-names>J</given-names>
						</name>
					</person-group>
					<article-title>The thioredoxin super-family: redundancy, specificity, and gray-area genomics</article-title>
					<source>J Bacteriol</source>
					<year>1999</year>
					<volume>181</volume>
					<issue>5</issue>
					<fpage>1375</fpage>
					<lpage>1379</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0022">
				<label>22</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Bessette</surname>
							<given-names>PH</given-names>
						</name>
						<name>
							<surname>Aslund</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Beckwith</surname>
							<given-names>J</given-names>
						</name>
						<name>
							<surname>Georgiou</surname>
							<given-names>G</given-names>
						</name>
					</person-group>
					<article-title>Efficient folding of proteins with multiple disulfide bonds in the Escherichia coli cytoplasm</article-title>
					<source>Proc Natl Acad Sci USA</source>
					<year>1999</year>
					<volume>96</volume>
					<issue>24</issue>
					<fpage>13703</fpage>
					<lpage>13708</lpage>
				</nlm-citation>
			</ref>
			<ref id="CIT0023">
				<label>23</label>
				<nlm-citation citation-type="journal">
					<person-group person-group-type="author">
						<name>
							<surname>Stewart</surname>
							<given-names>EJ</given-names>
						</name>
						<name>
							<surname>Aslund</surname>
							<given-names>F</given-names>
						</name>
						<name>
							<surname>Beckwith</surname>
							<given-names>J</given-names>
						</name>
					</person-group>
					<article-title>Disulfide bond formation in the Escherichia coli cytoplasm: an in vivo role reversal for the thioredoxins</article-title>
					<source>EMBO J</source>
					<year>1998</year>
					<volume>17</volume>
					<issue>19</issue>
					<fpage>5543</fpage>
					<lpage>5550</lpage>
				</nlm-citation>
			</ref>
		</ref-list>
	</back>
</article>
