<?xml version="1.0" encoding="utf-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "journalpublishing3.dtd">
<article xml:lang="en" article-type="research-article" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">AJMB</journal-id>
<journal-id journal-id-type="pmc">AJMB</journal-id>
<journal-id journal-id-type="nlm-ta">Avicenna Journal of Medical Biotechnology</journal-id>
<journal-title-group>
<journal-title>Avicenna Journal of Medical Biotechnology</journal-title>
</journal-title-group>
<issn pub-type="ppub">2008-2835</issn>
<issn pub-type="epub">2008-4625</issn>
<publisher>
<publisher-name>Avicenna Research Institute</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">AJMB-7-80</article-id>
<article-categories>
<subj-group>
<subject>Original Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Maternal Supplementary Folate Intake, Methylenetetrahydrofolate Reductase (<italic>MTHFR</italic>) C677T and A1298C Polymorphisms and the Risk of Orofacial Cleft in Iranian Children</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Ebadifar</surname>
<given-names>Asghar</given-names>
</name>
<xref ref-type="aff" rid="AFF1"><sup>1</sup></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>KhorramKhorshid</surname>
<given-names>Hamid Reza</given-names>
</name>
<xref ref-type="aff" rid="AFF2"><sup>2</sup></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Kamali</surname>
<given-names>Koorosh</given-names>
</name>
<xref ref-type="aff" rid="AFF3"><sup>3</sup></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Salehi Zeinabadi</surname>
<given-names>Mehdi</given-names>
</name>
<xref ref-type="aff" rid="AFF4"><sup>4</sup></xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Khoshbakht</surname>
<given-names>Tayyebeh</given-names>
</name>
<xref ref-type="aff" rid="AFF5"><sup>5</sup></xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ameli</surname>
<given-names>Nazila</given-names>
</name>
<xref ref-type="aff" rid="AFF6"><sup>6</sup></xref>
<xref ref-type="corresp" rid="C1"><sup>&#x0002A;</sup></xref>
</contrib>
</contrib-group>
<aff id="AFF1"><label>1</label>Dentofacial Deformities Research Center, Research Institute of Dental Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran</aff>
<aff id="AFF2"><label>2</label>Genetic Research Center, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran</aff>
<aff id="AFF3"><label>3</label>Reproductive Biotechnology Research Center, Avicenna Research Institute, ACECR, Tehran, Iran</aff>
<aff id="AFF4"><label>4</label>Pediatric Department, Dental School, Semnan University of Medical Sciences, Semnan, Iran</aff>
<aff id="AFF5"><label>5</label>Genetic Research Centre, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran</aff>
<aff id="AFF6"><label>6</label>Orthodontic Department, Dental school, Semnan University of Medical Sciences, Semnan, Iran</aff>
<author-notes>
<corresp id="C1"><label>&#x0002A;</label> <bold>Corresponding author:</bold> Nazila Ameli, DDS, MS, Orthodontic Department, Dental school, Semnan University of Medical Sciences, Semnan, Iran, <bold>Tel:</bold> &#x0002B;98 23 33448996, <bold>Fax:</bold> &#x0002B;98 23 33448999, <bold>E-mail:</bold> <email>nazilaa.aameli@gmail.com</email></corresp>
</author-notes>
<pub-date pub-type="ppub">
<season>April-June</season>
<year>2015</year>
</pub-date>
<pub-date pub-type="epub">
<month>4</month>
<year>2015</year>
</pub-date>
<volume>7</volume>
<issue>2</issue>
<fpage>80</fpage>
<lpage>84</lpage>
<history>
<date date-type="received">
<day>8</day>
<month>10</month>
<year>2014</year>
</date>
<date date-type="accepted">
<day>26</day>
<month>11</month>
<year>2014</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright&#x00A9; 2015 Avicenna Research Institute</copyright-statement>
<copyright-year>2015</copyright-year>
<license><license-p>This work is licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly.</license-p></license>
</permissions>
<abstract>
<sec><title>Background:</title>
<p>The purpose of this study was to describe the association of MTHFR gene single nucleotide polymorphisms (C677T and A1298C) and maternal supplementary folate intake with orofacial clefts in the Iranian population.</p>
</sec>
<sec><title>Methods:</title>
<p>In this case-control study, peripheral venous blood was taken from 65 patients with orofacial clefts and 215 unaffected controls for DNA extraction and kept in EDTA for further analysis. The genotyping was carried out using Polymerase Chain Reaction (PCR) followed by Restriction Fragment Length Polymorphism (RFLP) and gel electrophoresis. Data were analyzed using Chi square test and logistic regression tests.</p>
</sec>
<sec><title>Results:</title>
<p>Genotype frequencies of 677TT were reported to be 13.5 and 36.1&#x00025; in controls and CL/P patients, respectively, which showed a significant difference compared to CC as reference (OR&#x0003D;4.118; 95&#x00025; CI&#x0003D;1.997&#x02013;8.492; p&#x0003D;0.001). Conversely, 1298CC with frequencies of 10.8 and 12.7&#x00025; in controls and patients, respectively, showed no significant difference compared to AA (OR&#x0003D;2.359; 95&#x00025; CI&#x0003D;0.792&#x02013;7.023; p&#x0003D;0.123). Comparing patients whose mothers did not report the folate supplement intake during pregnancy, to controls, it was observed that lack of folate intake was a predisposing factor for having a child with oral clefts (OR&#x0003D;5/718, p&#x0003D;0.000).</p>
</sec>
<sec><title>Conclusion:</title>
<p>Children carrying the 677TT variant of the MTHFR gene may have an increased risk of CL/P. In addition, the finding that the risk associated with this allele was obviously higher when the mothers didn&#x02019;t use folic acid, supports the hypothesis that folic acid may play a role in the etiology of CL/P.</p>
</sec></abstract>
<kwd-group>
<kwd>Cleft lip</kwd>
<kwd>Cleft palate</kwd>
<kwd>Genes</kwd>
<kwd>Polymorphism</kwd>
</kwd-group></article-meta>
</front>
<body>
<sec sec-type="intro">
<title>Introduction</title>
<p>Cleft lip with or without cleft palate (CL/P) is among the most common orofacial congenital anomalies in the world <sup><xref ref-type="bibr" rid="B1">1</xref></sup>. Several epidemiological studies have reported the prevalence of cleft lip and/or palate in Iran and worldwide <sup><xref ref-type="bibr" rid="B2">2</xref>&#x02013;<xref ref-type="bibr" rid="B8">8</xref></sup>. Nonsyndromic CL/P (nsCL/P) follows a multifactorial inheritance pattern in which both environmental and genetic factors are considered to play a significant role <sup><xref ref-type="bibr" rid="B9">9</xref></sup>.</p>
<p>Determining the genetic risk factors of CL/P has been the subject of numerous studies <sup><xref ref-type="bibr" rid="B10">10</xref></sup>. Also, it has been claimed that environmental factors such as maternal folic acid intake affect the risk of orofacial clefts in some pregnancies, thus, it might be hypothesized that variants of genes involved in folic acid metabolism pathway, could be associated with the risk <sup><xref ref-type="bibr" rid="B9">9</xref>,<xref ref-type="bibr" rid="B11">11</xref></sup>. Among genes taking part in folate metabolism, the methylenetetrahydrofolate reductase gene (<italic>MTHFR</italic>) has been the most frequent one which is associated with nsCL/P <sup><xref ref-type="bibr" rid="B12">12</xref>&#x02013;<xref ref-type="bibr" rid="B14">14</xref></sup>.</p>
<p>It produces an enzyme which catalyzes the methylation of homocysteine amino acid to methionine. Any defect on this pathway can result in methionine deficiency and the accumulation of homocysteine. In addition to critical role of methionine as an important precursor in the DNA and RNA methylation process, high serum homocysteine levels are teratogenic during the embryogenesis <sup><xref ref-type="bibr" rid="B15">15</xref>,<xref ref-type="bibr" rid="B16">16</xref></sup>.</p>
<p>Within the <italic>MTHFR</italic> gene, two common polymerphisms, (C---T) and (A---C), exist at positions 677 and 1298, respectively <sup><xref ref-type="bibr" rid="B17">17</xref></sup>. Several associations have been reported between the polymorphisms in the <italic>MTHFR</italic> gene and the risk of nsCL/P <sup><xref ref-type="bibr" rid="B12">12</xref>&#x02013;<xref ref-type="bibr" rid="B14">14</xref></sup>. However, results have been contradictory as in a study conducted by Han <italic>et al</italic>. It was shown that A1298C polymorphism would have a protective role rather than being a predisposing factor for cleft lip and palate <sup><xref ref-type="bibr" rid="B18">18</xref></sup>.</p>
<p>Numerous studies evaluated the relationship between MTHFR gene polymorphisms and nsCL/P but none of them examined Iranian patients. As a comprehensive genetic study on CL/P, a case-control study of the <italic>MTHFR</italic> polymorphisms was performed. The main objective of the present study was to determine the association between nsCL/P and C677T, A1298C polymorphisms in the <italic>MTHFR</italic> gene and the role of maternal supplementary folate intake as a risk factor for non-syndromic orofacial clefts.</p>
</sec>
<sec sec-type="materials|methods">
<title>Materials and Methods</title>
<p>In this study, 65 patients with nonsyndromic CL/P (isolated CL/P without any other organ disorders) and 215 unaffected controls were included which were matched to cases regarding age, gender and socioeconomic status. Patients with other facial or skeletal malformations, metabolic or neurologic disorders or anomalies of other organ systems were excluded. Samples were recruited from Mofid Hospital in Tehran, Iran in 2012&#x02013;2013. Ethical approval for the study was obtained from the Ethics Committee of the Dental Research Center in Shahid Beheshti University for dentofacial deformities. Informed consent was obtained from all parents.</p>
<p>Questions on family members were intended to find other affected family members or possible minimal variants of orofacial clefts among relatives. In order to identify any possible prenatal contributory teratogenic factor that might have influenced the development of CL/P, a detailed questionnaire was applied. The questionnaire was modeled on the Centers for Disease Control (CDC) questionnaire for risk factor surveillance for birth defects (<ext-link xlink:href="www.cdc.gov/surveillanceepractice/a_z.html" ext-link-type="uri">www.cdc.gov/surveillanceepractice/a_z.html</ext-link>). All mothers were questioned for maternal illnesses, medication intake, history of abortion, history of cardiovascular diseases, and smoking. In this way, confounding factors associated with orofacial clefts could be limited. Control children whose mothers reported positive history of mentioned factors were excluded. In addition, the history of folate intake during the periconceptional period (ranging from 3 months prior to 1 month after conception) was evaluated through questionnaire among mothers of cases.</p>
<p>Peripheral venous blood was taken for DNA extraction from all affected individuals and controls.</p>
<sec sec-type="methods">
<title>Genotype analysis</title>
<p>Blood samples were collected in tubes containing 200 <italic>&#x003BC;l</italic> of 0.5 <italic>M</italic> EDTA and stored at &#x02212;80&#x000B0;<italic>C</italic> until further analysis. Genotyping for C677T and A1298C gene mutations were performed by enzymatic restriction digestion of PCR products with Hinf I and MboII enzymes, respectively <sup><xref ref-type="bibr" rid="B19">19</xref>,<xref ref-type="bibr" rid="B20">20</xref></sup>.</p>
<p>For screening the 677C---T and 1298A---C variants in the <italic>MTHFR</italic> gene, exons 4 and 7 of the gene were amplified by Polymerase Chain Reaction (PCR) following standard conditions and with the use of modified primers (4F:5&#x02032;-TCTTCATCCCTCGCCTTGAA C3&#x02032;; 4R: 5&#x02032; -AGGACGGTGCGGTGAGAGTG-3&#x02032;) and (7F: 5&#x02032;- CTTCTACCTGAAGAGCAAGTC -3&#x02032; 7R: 5&#x02032;- CATGTCCACAGCATGGAG -3&#x02032;), respectively. DNA fragments were separated and visualized by electrophoresis using 8&#x00025; polyacrylamide gels (<xref ref-type="fig" rid="F1">Figures 1</xref> and <xref ref-type="fig" rid="F2">2</xref>).</p>
<fig id="F1" position="float">
<label>Figure 1.</label>
<caption>
<p>PCR-RFLP pattern of MTHFR C677T polymorphism digested with Hinf1 restriction enzyme.</p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-7-80f1.tif"/>
</fig>
<fig id="F2" position="float">
<label>Figure 2.</label>
<caption>
<p>PCR-RFLP pattern of MTHFR A1298C polymorphism digested with Mbo II restriction enzyme.</p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-7-80f2.tif"/>
</fig>
</sec>
<sec sec-type="methods">
<title>Statistical methods</title>
<p>Statistical analyses were performed using SPSS 11.5 software and data were shown as the allele frequencies and percentages. Chi square test was used to determine the difference in the genotype and gene frequency. Odds Ratios (OR) with 95&#x00025; Confidence Interval (CI) were calculated from logistic regression models. P&#x0003C;0.05 was considered to indicate a statistically significant result.</p>
</sec>
</sec>
<sec sec-type="results">
<title>Results</title>
<p>There were three genotypes for each variant (CC, CT and TT for C677T and AA, CC and AC for A1298C), in <italic>MTHFR</italic> gene in the two groups. <xref ref-type="table" rid="T1">Table 1</xref> shows that compared to the CC genotype, the TT genotype was significantly correlated with an increased risk of CL/P (OR&#x0003D;4.1; 95&#x00025; CI&#x0003D;2&#x02013;8.5; p&#x0003C;0.001) while comparing to the AA genotype, the CC genotype did not show a significant difference (OR&#x0003D;2.4; 95&#x00025; CI&#x0003D;0.8&#x02013;7; p&#x0003D;0.123).</p>
<table-wrap id="T1" position="float">
<label>Table 1.</label>
<caption><p><italic>MTHFR</italic> C677T and A1298C genotype frequencies and the CL/P risk</p></caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="middle"><bold>Genotype</bold></th>
<th align="center" valign="middle"><bold>Controls (n&#x0003D;215) N (%)</bold></th>
<th align="center" valign="middle"><bold>Cases (n&#x0003D;61) N (%)</bold></th>
<th align="center" valign="middle"><bold>p-value</bold></th>
<th align="center" valign="middle"><bold>OR (CI 95%)</bold></th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="middle"><bold>C677T/CC</bold></td>
<td align="center" valign="middle">114 (53)</td>
<td align="center" valign="middle">21(34.4)</td>
<td align="center" valign="middle">--</td>
<td align="center" valign="middle">Reference group</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>C677T/CT</bold></td>
<td align="center" valign="middle">72 (33.5)</td>
<td align="center" valign="middle">18 (29.5)</td>
<td align="center" valign="middle">0.389</td>
<td align="center" valign="middle">1.35 (0.68&#x02013;2.7)</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>C677T/TT</bold></td>
<td align="center" valign="middle">29 (13.5)</td>
<td align="center" valign="middle">22 (36.1)</td>
<td align="center" valign="middle">0.001</td>
<td align="center" valign="middle">4.1(2&#x02013;8.5)</td>
</tr>
<tr>
<td colspan="5" align="center" valign="middle"><hr/></td>
</tr>
<tr>
<td align="left" valign="middle"/>
<td align="center" valign="middle"><bold>Controls (n&#x0003D;189) N (%)</bold></td>
<td align="center" valign="middle"><bold>Cases (n&#x0003D;65) N (%)</bold></td>
<td align="center" valign="middle"><bold>p-value</bold></td>
<td align="center" valign="middle"><bold>OR (CI&#x0003D;95%)</bold></td>
</tr>
<tr>
<td colspan="5" align="center" valign="middle"><hr/></td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A1298C/AA</bold></td>
<td align="center" valign="middle">73 (38.6)</td>
<td align="center" valign="middle">24 (36.9)</td>
<td align="center" valign="middle"/>
<td align="center" valign="middle">Reference group</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A1298C/AC</bold></td>
<td align="center" valign="middle">92 (48.7)</td>
<td align="center" valign="middle">34 (52.3)</td>
<td align="center" valign="middle">0.705</td>
<td align="center" valign="middle">1.124</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A1298C/CC</bold></td>
<td align="center" valign="middle">24 (12.7)</td>
<td align="center" valign="middle">7 (10.8)</td>
<td align="center" valign="middle">0.807</td>
<td align="center" valign="middle">0.887</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TFN1"><p>(CI&#x0003D; Confidence Interval, N&#x0003D; Number, OR&#x0003D; Odds Ratio)</p></fn>
</table-wrap-foot>
</table-wrap>
<p>According to <xref ref-type="table" rid="T2">table 2</xref>, the frequencies of the C and T alleles of C677T and A and C alleles of A1298C were 69.7&#x00025;, 30.3&#x00025;, 62.9&#x00025; and 37.1&#x00025; in the control group, respectively and 49.1&#x00025;, 50.9&#x00025;, 63.1&#x00025; and 36.9&#x00025; in the CL/P group, respectively.</p>
<table-wrap id="T2" position="float">
<label>Table 2.</label>
<caption><p>MTHFR C677T and A1298C allele frequencies between two groups</p></caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="middle"><bold>Alleles</bold></th>
<th align="center" valign="middle"><bold>Controls (n&#x0003D;215)</bold></th>
<th align="center" valign="middle"><bold>Cases (n&#x0003D;61)</bold></th>
<th align="center" valign="middle"><bold>p-value</bold></th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="middle"><bold>C(C677T)</bold></td>
<td align="center" valign="middle">300</td>
<td align="center" valign="middle">60</td>
<td align="center" valign="middle" rowspan="2">0.001</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>T(C677T)</bold></td>
<td align="center" valign="middle">130</td>
<td align="center" valign="middle">62</td>
</tr>
<tr>
<td colspan="4" align="center" valign="middle"><hr/></td>
</tr>
<tr>
<td align="left" valign="middle"><bold>Alleles</bold></td>
<td align="center" valign="middle"><bold>Controls (n&#x0003D;189)</bold></td>
<td align="center" valign="middle"><bold>Cases (n&#x0003D;65)</bold></td>
<td align="center" valign="middle"><bold>p-value</bold></td>
</tr>
<tr>
<td colspan="4" align="center" valign="middle"><hr/></td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A(A1298C)</bold></td>
<td align="center" valign="middle">238</td>
<td align="center" valign="middle">82</td>
<td align="center" valign="middle" rowspan="2">0.981</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>C(A1298C)</bold></td>
<td align="center" valign="middle">140</td>
<td align="center" valign="middle">48</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Moreover, the cases were divided into two separate groups according to maternal folate intake history. Group 1 included CL/P children whose mothers had reported folate supplement intake in the questionnaire (n&#x0003D;23, 37.1&#x00025; in C677T and n&#x0003D;26, 40&#x00025; in A1298C) which is shown in <xref ref-type="table" rid="T3">table 3</xref>, and group 2 included affected children whose mothers did not mention folate supplement intake (n&#x0003D;39, 62.9&#x00025; in C677T and n&#x0003D;39, 60&#x00025; in A1298C) (<xref ref-type="table" rid="T4">Table 4</xref>).</p>
<table-wrap id="T3" position="float">
<label>Table 3.</label>
<caption><p><italic>MTHFR</italic> C677T and A1298C genotypes and the risk of CL/P in cases with positive history of maternal folate intake</p></caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="middle"><bold>Genotype</bold></th>
<th align="center" valign="middle"><bold>p-value</bold></th>
<th align="center" valign="middle"><bold>OR</bold></th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="middle"><bold>C677T/CC</bold></td>
<td align="center" valign="middle">Not Applicable</td>
<td align="center" valign="middle">1</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>C677T/CT</bold></td>
<td align="center" valign="middle">0.842</td>
<td align="center" valign="middle">1.1</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>C677T/TT</bold></td>
<td align="center" valign="middle">0.123</td>
<td align="center" valign="middle">2.4</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A1298C/AA</bold></td>
<td align="center" valign="middle">Not applicable</td>
<td align="center" valign="middle">1</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A1298C/AC</bold></td>
<td align="center" valign="middle">0.690</td>
<td align="center" valign="middle">1.2</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A1298C/CC</bold></td>
<td align="center" valign="middle">0.268</td>
<td align="center" valign="middle">0.3</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TFN2"><p>(OR&#x0003D; Odds Ratio)</p></fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="T4" position="float">
<label>Table 4.</label>
<caption><p><italic>MTHFR</italic> C677T and A1298C genotypes and the risk of CL/P in cases with negative history of maternal folate intake</p></caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left" valign="middle"><bold>Genotype</bold></th>
<th align="center" valign="middle"><bold>p-value</bold></th>
<th align="center" valign="middle"><bold>OR 95% CI</bold></th>
</tr>
</thead>
<tbody>
<tr>
<td align="left" valign="middle"><bold>C677T/CC</bold></td>
<td align="center" valign="middle">Not Applicable</td>
<td align="center" valign="middle">1</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>C677T/CT</bold></td>
<td align="center" valign="middle">0.310</td>
<td align="center" valign="middle">1.6 (0.65&#x02013;3.8)</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>C677T/TT</bold></td>
<td align="center" valign="middle">0.001</td>
<td align="center" valign="middle">5.7 (2.4&#x02013;13.6)</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A1298C/AA</bold></td>
<td align="center" valign="middle">Not applicable</td>
<td align="center" valign="middle">1</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A1298C/AC</bold></td>
<td align="center" valign="middle">0.848</td>
<td align="center" valign="middle">1.1</td>
</tr>
<tr>
<td align="left" valign="middle"><bold>A1298C/CC</bold></td>
<td align="center" valign="middle">0.625</td>
<td align="center" valign="middle">1.3</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TFN3"><p>(OR&#x0003D; Odds Ratio)</p></fn>
</table-wrap-foot>
</table-wrap>
<p>According to <xref ref-type="table" rid="T4">table 4</xref>, compared to the CC genotype, the TT genotype was significantly correlated with an increased risk of CL/P in group 2 and this correlation was greater than the amount found in <xref ref-type="table" rid="T1">Table 1</xref> for all of the patients compared to controls (OR&#x0003D;5.7 <italic>vs</italic>. OR&#x0003D; 4.1), while this correlation was not significant according to A1298C genotypes. This finding supports the preventive effect of folate intake even in those with predisposing genotype.</p>
</sec>
<sec sec-type="discussion">
<title>Discussion</title>
<p><italic>MTHFR</italic> is one of the major enzymes in the metabolism of folic acid which catalyzes the irreversible reduction of 5, 10- methylenetetrahydrofolate to 5- methylenetetrahydrofolate <sup><xref ref-type="bibr" rid="B21">21</xref></sup>. A change of C to T at nucleotide 677 and A to C at nucleotide 1298 in <italic>MTHFR</italic> C677T and A1298C, results in an amino acid sequence change of an alanine to valine and glutamine to alanine, respectively. Mutant protein has reduced enzyme activity which leads to DNA hypomethylation and may induce genomic instability, thereby affecting the expression of oncogenes or tumor suppressor genes <sup><xref ref-type="bibr" rid="B22">22</xref></sup>. Several studies have been conducted to determine the association between the two functional polymorphisms (C677T and A1298C) in <italic>MTHFR</italic> gene and an increased risk of CL/P <sup><xref ref-type="bibr" rid="B23">23</xref>,<xref ref-type="bibr" rid="B24">24</xref></sup>. However, the results are inconsistent due to differences in the studied populations, various genetic backgrounds and different exposures to diverse environmental risk factors, as discussed in detail below.</p>
<p>The results from the present study suggest that there is an association between the <italic>MTHFR</italic> C667T mutation and CL/P incidence while the correlation between A198C polymorphism and oral clefts is not supported. Several previous studies presented that the T allele of the <italic>MTHFR</italic> C677T polymorphism might be involved in the development of CL/Ps. Similar to our results, Wan <italic>et al</italic> found that the genetic polymorphism of <italic>MTHFR</italic> C677T is associated with the development of nonsyndromic cleft lip and palate in Chinese population <sup><xref ref-type="bibr" rid="B25">25</xref></sup>.</p>
<p>Also, a meta-analysis demonstrated that among Asians, CT heterozygote, TT homozygote and CT/TT of infants&#x02019; <italic>MTHFR</italic> C677T variant could contribute to elevated risk of nonsyndromic orofacial clefts, compared with CC wild-type homozygote (OR&#x0003D;1.74 for CT <italic>vs</italic>. CC, OR&#x0003D;2.3 for TT <italic>vs</italic>. CC and OR&#x0003D;1.74 for CT/TT <italic>vs</italic>. CC) <sup><xref ref-type="bibr" rid="B12">12</xref></sup>.</p>
<p>In addition, comparable studies could not show any association between the C677T polymorphism and CL/ P. Several explanations might be responsible for these discrepant findings. For neural tube defects (NTD), it has been claimed that <italic>MTHFR</italic> C677T polymorphism may only be a risk factor in populations with poor folate nutrition but under condition of complete folate status, potential association may be masked. Similarly, the <italic>MTHFR</italic> 677T risk allele may only have a significant role in the etiology of nonsyndromic CL/Ps under the conditions of overall folate deficiency <sup><xref ref-type="bibr" rid="B10">10</xref></sup>.</p>
<p>Several studies have shown no significant relationship between A1298C polymorphism and oral clefts. In a study by Jagomagi <italic>et al</italic>, it was reported that A1298C polymorphism is not directly connected to the risk of developing CL/P <sup><xref ref-type="bibr" rid="B10">10</xref></sup>. Moreover, many studies have shown similar results <sup><xref ref-type="bibr" rid="B13">13</xref>,<xref ref-type="bibr" rid="B14">14</xref></sup>.</p>
<p>Conversely, in several studies, a protective role of A1298C polymorphism has been reported <sup><xref ref-type="bibr" rid="B12">12</xref>,<xref ref-type="bibr" rid="B18">18</xref></sup>. Han <italic>et al</italic> in a study of Chinese patients demonstrated that 1298AC and CC genotype frequencies were significantly greater in control group compared to CL/P patients, emphasizing the protective role of this polymerphism <sup><xref ref-type="bibr" rid="B18">18</xref></sup>.</p>
<p>In this study, an inverse association was found between positive history of maternal folate intake and CL/P in children, which could be representative of preventive role of acid folic. The results of previous studies have been inconsistent. Kelly <italic>et al</italic> reported that taking folic acid might partially prevent cleft lip and palate <sup><xref ref-type="bibr" rid="B26">26</xref></sup>. In a study of gene-environment interaction between the <italic>MTHFR</italic> C677T polymorphism and folic acid in the etiology of orofacial clefts, Butali <italic>et al</italic> demonstrated a reduced risk of CL/P with maternal folic acid use (OR&#x0003D;0.7, p&#x0003D;0.008) and with supplements containing folic acid (OR&#x0003D;0.8, p&#x0003D;0.028) <sup><xref ref-type="bibr" rid="B27">27</xref></sup>. These findings could be explained by the critical role of folic acid on the prevention of recurrence and occurrence of neural tube defects <sup><xref ref-type="bibr" rid="B28">28</xref></sup>.</p>
<p>Conversely, in a study of all types of clefts in the U.K, Little <italic>et al</italic> observed that the maternal serum or plasma folate levels do not have any association with CL/P in children <sup><xref ref-type="bibr" rid="B29">29</xref></sup>. This finding may point to the possible complexity of etiologically associated factors. Munger <italic>et al</italic>, using the L. casei assay in the Philippines, found that the mean red cell folate level of mothers of CL/P cases was significantly higher than that in control mothers in the two geographic areas <sup><xref ref-type="bibr" rid="B30">30</xref></sup>. However, a complicating issue may be differences in the method used to assess maternal folate status.</p>
<p>The lack of supplementary folate intake found to be associated with increased risk of oral clefts in this study, can be corrected by folic acid, even in relatively small doses. Thus, our study shows the importance of educating people regarding the critical role of folic acid supplements in reducing oral clefts.</p>
</sec>
<sec sec-type="conclusion">
<title>Conclusion</title>
<p>In conclusion, it was found that children carrying the 677TT variant of the <italic>MTHFR</italic> gene may have an increased risk of CL/P. In addition, the finding that the risk associated with this allele was obviously higher when the mothers did not use folic acid, supports the hypothesis that folic acid may play a role in the etiology of CL/P. However, studies of various designs with larger sample sizes and different methods of measuring vitamin consumption are suggested to clarify the role of <italic>MTHFR</italic> in orofacial clefts.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgement</title>
<p>This study is the result of the research performed by Dr. Nazila Ameli for her post-graduate degree in Orthodontics under Dr. Ebadifar supervision. We would like to thank Dr Rozrokh (Head of Mofid Hospital), Mofid Hospital staff (Mrs Asgari and Mrs Safavi) and Genetic Research Center (Ms Moghadam) for their kind help in recruiting study subjects and contributions in the genetic analysis. Moreover, the research was granted by Dentofacial Deformities Research Center, Research Institute of Dental Sciences, Shahid Behehsti University of Medical Sciences, Tehran, Iran.</p>
</ack>
<sec>
<title>Conflict of Interest</title>
<p>None declared.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<label>1.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Mirfazeli</surname><given-names>A</given-names></name>
<name><surname>Kaviany</surname><given-names>N</given-names></name>
<name><surname>Hosseinpour</surname><given-names>KR</given-names></name>
<name><surname>Golalipour</surname><given-names>MJ</given-names></name>
</person-group>. 
<article-title>Incidence of cleft lip and palate in Gorgan-Northern Iran: an epidemiological study</article-title>. 
<source>Oman Med J</source> 
<year>2012</year>;
<volume>27</volume>
(<issue>6</issue>): 
<fpage>461</fpage>&#x02013;
<lpage>464</lpage>.
</mixed-citation>
</ref>
<ref id="B2">
<label>2.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Leck</surname><given-names>I</given-names></name>
</person-group>. 
<article-title>The geographical distribution of neural tube defects and oral clefts</article-title>. 
<source>Br Med Bull</source> 
<year>1984</year>;
<volume>40</volume>
(<issue>4</issue>):
<fpage>390</fpage>&#x02013;
<lpage>395</lpage>.
</mixed-citation>
</ref>
<ref id="B3">
<label>3.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Farhud</surname><given-names>DD</given-names></name>
<name><surname>Walizadeh</surname><given-names>GR</given-names></name>
<name><surname>Kamali</surname><given-names>MS</given-names></name>
</person-group>. 
<article-title>Congenital malformations and genetic diseases in Iranian infants</article-title>. 
<source>Hum Genet</source> 
<year>1986</year>;
<volume>74</volume>
(<issue>4</issue>):
<fpage>382</fpage>&#x02013;
<lpage>385</lpage>.
</mixed-citation>
</ref>
<ref id="B4">
<label>4.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Das</surname><given-names>SK</given-names></name>
<name><surname>Runnels</surname><given-names>RS</given-names><suffix>Jr</suffix></name>
<name><surname>Smith</surname><given-names>JC</given-names></name>
<name><surname>Cohly</surname><given-names>HH</given-names></name>
</person-group>. 
<article-title>Epidemiology of cleft lip and cleft palate in Mississippi</article-title>. 
<source>South Med J</source> 
<year>1995</year>;
<volume>88</volume>
(<issue>4</issue>):
<fpage>437</fpage>&#x02013;
<lpage>442</lpage>.
</mixed-citation>
</ref>
<ref id="B5">
<label>5.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Derijcke</surname><given-names>A</given-names></name>
<name><surname>Eerens</surname><given-names>A</given-names></name>
<name><surname>Carels</surname><given-names>C</given-names></name>
</person-group>. 
<article-title>The incidence of oral clefts: a review</article-title>. 
<source>Br J Oral Maxillofac Surg</source> 
<year>1996</year>;
<volume>34</volume>
(<issue>6</issue>): 
<fpage>488</fpage>&#x02013;
<lpage>494</lpage>.
</mixed-citation>
</ref>
<ref id="B6">
<label>6.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Rajabian</surname><given-names>MH</given-names></name>
<name><surname>Sherkat</surname><given-names>M</given-names></name>
</person-group>. 
<article-title>An epidemiologic study of oral clefts in Iran: analysis of 1,669 cases</article-title>. 
<source>Cleft Palate Craniofac J</source> 
<year>2000</year>;
<volume>37</volume>
(<issue>2</issue>):
<fpage>191</fpage>&#x02013;
<lpage>196</lpage>.
</mixed-citation>
</ref>
<ref id="B7">
<label>7.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Robert</surname><given-names>E</given-names></name>
<name><surname>KallEn</surname><given-names>B</given-names></name>
<name><surname>Harris</surname><given-names>J</given-names></name>
</person-group>. 
<article-title>The epidemiology of orofacial clefts. Some general epidemiological characteristics</article-title>. 
<source>J Craniofac Genet Dev Biol</source> 
<year>1996</year>;
<volume>16</volume>
(<issue>4</issue>):
<fpage>234</fpage>&#x02013;
<lpage>241</lpage>.
</mixed-citation>
</ref>
<ref id="B8">
<label>8.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Taher</surname><given-names>AA</given-names></name>
</person-group>. 
<article-title>Cleft lip and palate in Tehran</article-title>. 
<source>Cleft Palate Craniofac J</source> 
<year>1992</year>;
<volume>29</volume>
(<issue>1</issue>):
<fpage>15</fpage>&#x02013;
<lpage>16</lpage>.
</mixed-citation>
</ref>
<ref id="B9">
<label>9.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Semic-Jusufagic</surname><given-names>A</given-names></name>
<name><surname>Bircan</surname><given-names>R</given-names></name>
<name><surname>Celebiler</surname><given-names>O</given-names></name>
<name><surname>Erdim</surname><given-names>M</given-names></name>
<name><surname>Akarsu</surname><given-names>N</given-names></name>
<name><surname>Elcioglu</surname><given-names>NH</given-names></name>
</person-group>. 
<article-title>Association between C677T and A1298C MTHFR gene polymorphism and nonsyndromic orofacial clefts in the Turkish population: a case-parent study</article-title>. 
<source>Turk J Pediatr</source> 
<year>2012</year>;
<volume>54</volume>
(<issue>6</issue>):
<fpage>617</fpage>&#x02013;
<lpage>625</lpage>.
</mixed-citation>
</ref>
<ref id="B10">
<label>10.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Jagomagi</surname><given-names>T</given-names></name>
<name><surname>Nikopensius</surname><given-names>T</given-names></name>
<name><surname>Krjutskov</surname><given-names>K</given-names></name>
<name><surname>Tammekivi</surname><given-names>V</given-names></name>
<name><surname>Viltrop</surname><given-names>T</given-names></name>
<name><surname>Saag</surname><given-names>M</given-names></name><etal/>
</person-group>. 
<article-title>MTHFR and MSX1 contribute to the risk of nonsyndromic cleft lip/palate</article-title>. 
<source>Eur J Oral Sci</source> 
<year>2010</year>;
<volume>118</volume>
(<issue>3</issue>):
<fpage>213</fpage>&#x02013;
<lpage>220</lpage>.
</mixed-citation>
</ref>
<ref id="B11">
<label>11.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Aslar</surname><given-names>D</given-names></name>
<name><surname>Ozdiler</surname><given-names>E</given-names></name>
<name><surname>Altug</surname><given-names>AT</given-names></name>
<name><surname>Tastan</surname><given-names>H</given-names></name>
</person-group>. 
<article-title>Determination of Methylenetetrahydrofolate Reductase (MTHFR) gene polymorphism in Turkish patients with nonsyndromic cleft lip and palate</article-title>. 
<source>Int J Pediatr Otorhinolaryngol</source> 
<year>2013</year>; 
<volume>77</volume>
(<issue>7</issue>):
<fpage>1143</fpage>&#x02013;
<lpage>1146</lpage>.
</mixed-citation>
</ref>
<ref id="B12">
<label>12.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Pan</surname><given-names>Y</given-names></name>
<name><surname>Zhang</surname><given-names>W</given-names></name>
<name><surname>Ma</surname><given-names>J</given-names></name>
<name><surname>Du</surname><given-names>Y</given-names></name>
<name><surname>Li</surname><given-names>D</given-names></name>
<name><surname>Cai</surname><given-names>Q</given-names></name><etal/>
</person-group>. 
<article-title>Infants&#x00027; MTHFR polymorphisms and nonsyndromic orofacial clefts susceptibility: a metaanalysis based on 17 casecontrol studies</article-title>. 
<source>Am J Med Genet A</source> 
<year>2012</year>;
<volume>158A</volume>
(<issue>9</issue>):
<fpage>2162</fpage>&#x02013;
<lpage>2169</lpage>.
</mixed-citation>
</ref>
<ref id="B13">
<label>13.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Jugessur</surname><given-names>A</given-names></name>
<name><surname>Wilcox</surname><given-names>AJ</given-names></name>
<name><surname>Lie</surname><given-names>RT</given-names></name>
<name><surname>Murray</surname><given-names>JC</given-names></name>
<name><surname>Taylor</surname><given-names>JA</given-names></name>
<name><surname>Ulvik</surname><given-names>A</given-names></name><etal/>
</person-group>. 
<article-title>Exploring the effects of methylenetetrahydrofolate reductase gene variants C677T and A1298C on the risk of orofacial clefts in 261 Norwegian case-parent triads</article-title>. 
<source>Am J Epidemiol</source> 
<year>2003</year>;
<volume>157</volume>
(<issue>12</issue>):
<fpage>1083</fpage>&#x02013;
<lpage>1091</lpage>.
</mixed-citation>
</ref>
<ref id="B14">
<label>14.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Mills</surname><given-names>JL</given-names></name>
<name><surname>Molloy</surname><given-names>AM</given-names></name>
<name><surname>Parle-McDermott</surname><given-names>A</given-names></name>
<name><surname>Troendle</surname><given-names>JF</given-names></name>
<name><surname>Brody</surname><given-names>LC</given-names></name>
<name><surname>Conley</surname><given-names>MR</given-names></name><etal/>
</person-group>. 
<article-title>Folate-related gene polymorphisms as risk factors for cleft lip and cleft palate</article-title>. 
<source>Birth Defects Res A Clin Mol Teratol</source> 
<year>2008</year>;
<volume>82</volume>
(<issue>9</issue>):
<fpage>636</fpage>&#x02013;
<lpage>643</lpage>.
</mixed-citation>
</ref>
<ref id="B15">
<label>15.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Limpach</surname><given-names>A</given-names></name>
<name><surname>Dalton</surname><given-names>M</given-names></name>
<name><surname>Miles</surname><given-names>R</given-names></name>
<name><surname>Gadson</surname><given-names>P</given-names></name>
</person-group>. 
<article-title>Homocysteine inhibits retinoic acid synthesis: a mechanism for homocysteine-induced congenital defects</article-title>. 
<source>Exp Cell Res</source> 
<year>2000</year>;
<volume>260</volume>
(<issue>1</issue>):
<fpage>166</fpage>&#x02013;
<lpage>174</lpage>.
</mixed-citation>
</ref>
<ref id="B16">
<label>16.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Greene</surname><given-names>ND</given-names></name>
<name><surname>Dunlevy</surname><given-names>LE</given-names></name>
<name><surname>Copp</surname><given-names>AJ</given-names></name>
</person-group>. 
<article-title>Homocysteine is embryotoxic but does not cause neural tube defects in mouse embryos</article-title>. 
<source>Anat Embryol (Berl)</source> 
<year>2003</year>;
<volume>206</volume>
(<issue>3</issue>):
<fpage>185</fpage>&#x02013;
<lpage>191</lpage>.
</mixed-citation>
</ref>
<ref id="B17">
<label>17.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Reutter</surname><given-names>H</given-names></name>
<name><surname>Birnbaum</surname><given-names>S</given-names></name>
<name><surname>Lacava</surname><given-names>AD</given-names></name>
<name><surname>Mende</surname><given-names>M</given-names></name>
<name><surname>Henschke</surname><given-names>H</given-names></name>
<name><surname>Berge</surname><given-names>S</given-names></name><etal/>
</person-group>. 
<article-title>Family-based association study of the MTHFR polymorphism C677T in patients with nonsyndromic cleft lip and palate from central Europe</article-title>. 
<source>Cleft Palate Craniofac J</source> 
<year>2008</year>;
<volume>45</volume>
(<issue>3</issue>):
<fpage>267</fpage>&#x02013;
<lpage>271</lpage>.
</mixed-citation>
</ref>
<ref id="B18">
<label>18.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Han</surname><given-names>Y</given-names></name>
<name><surname>Pan</surname><given-names>Y</given-names></name>
<name><surname>Du</surname><given-names>Y</given-names></name>
<name><surname>Tong</surname><given-names>N</given-names></name>
<name><surname>Wang</surname><given-names>M</given-names></name>
<name><surname>Zhang</surname><given-names>Z</given-names></name><etal/>
</person-group>. 
<article-title>Methylenetetrahydrofolate reductase C677T and A1298C polymorphisms and nonsyndromic orofacial clefts susceptibility in a southern Chinese population</article-title>. 
<source>DNA Cell Biol</source> 
<year>2011</year>;
<volume>30</volume>
(<issue>12</issue>):
<fpage>1063</fpage>&#x02013;
<lpage>1068</lpage>.
</mixed-citation>
</ref>
<ref id="B19">
<label>19.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>van der Put</surname><given-names>NM</given-names></name>
<name><surname>Steegers-Theunissen</surname><given-names>RP</given-names></name>
<name><surname>Frosst</surname><given-names>P</given-names></name>
<name><surname>Trijbels</surname><given-names>FJ</given-names></name>
<name><surname>Eskes</surname><given-names>TK</given-names></name>
<name><surname>van den Heuvel</surname><given-names>LP</given-names></name><etal/>
</person-group>. 
<article-title>Mutated methylenetetrahydrofolate reductase as a risk factor for spina bifida</article-title>. 
<source>Lancet</source> 
<year>1995</year>;
<volume>346</volume>
(<issue>8982</issue>):
<fpage>1070</fpage>&#x02013;
<lpage>1071</lpage>.
</mixed-citation>
</ref>
<ref id="B20">
<label>20.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>van der Put</surname><given-names>NM</given-names></name>
<name><surname>Gabreels</surname><given-names>F</given-names></name>
<name><surname>Stevens</surname><given-names>EM</given-names></name>
<name><surname>Smeitink</surname><given-names>JA</given-names></name>
<name><surname>Trijbels</surname><given-names>FJ</given-names></name>
<name><surname>Eskes</surname><given-names>TK</given-names></name><etal/>
</person-group>. 
<article-title>A second common mutation in the methylenetetrahydrofolate reductase gene: an additional risk factor for neural-tube defects?</article-title> 
<source>Am J Hum Genet</source> 
<year>1998</year>;
<volume>62</volume>
(<issue>5</issue>):
<fpage>1044</fpage>&#x02013;
<lpage>1051</lpage>.
</mixed-citation>
</ref>
<ref id="B21">
<label>21.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Gudnason</surname><given-names>V</given-names></name>
<name><surname>Stansbie</surname><given-names>D</given-names></name>
<name><surname>Scott</surname><given-names>J</given-names></name>
<name><surname>Bowron</surname><given-names>A</given-names></name>
<name><surname>Nicaud</surname><given-names>V</given-names></name>
<name><surname>Humphries</surname><given-names>S</given-names></name>
</person-group>. 
<article-title>C677T (thermolabile alanine/valine) polymorphism in methylenetetrahydrofolate reductase (MTH FR): its frequency and impact on plasma homocysteine concentration in different European populations. EARS group</article-title>. 
<source>Atherosclerosis</source> 
<year>1998</year>;
<volume>136</volume>
(<issue>2</issue>):
<fpage>347</fpage>&#x02013;
<lpage>354</lpage>.
</mixed-citation>
</ref>
<ref id="B22">
<label>22.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Yin</surname><given-names>G</given-names></name>
<name><surname>Ming</surname><given-names>H</given-names></name>
<name><surname>Zheng</surname><given-names>X</given-names></name>
<name><surname>Xuan</surname><given-names>Y</given-names></name>
<name><surname>Liang</surname><given-names>J</given-names></name>
<name><surname>Jin</surname><given-names>X</given-names></name>
</person-group>. 
<article-title>Methylenetetrahydrofolate reductase C677T gene polymerphism and colorectal cancer risk: A case-control study</article-title>. 
<source>Oncol Lett</source> 
<year>2012</year>;
<volume>4</volume>
(<issue>2</issue>):
<fpage>365</fpage>&#x02013;
<lpage>369</lpage>.
</mixed-citation>
</ref>
<ref id="B23">
<label>23.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wang</surname><given-names>SM</given-names></name>
<name><surname>Wang</surname><given-names>JH</given-names></name>
<name><surname>Yu</surname><given-names>JC</given-names></name>
<name><surname>Wei</surname><given-names>B</given-names></name>
<name><surname>Wang</surname><given-names>KH</given-names></name>
<name><surname>Liu</surname><given-names>JY</given-names></name><etal/>
</person-group>. 
<article-title>&#x0005B;Association between parental MTHFR gene polymorphism 677C/T and nonsyndromic cleft lip and palate in offspring&#x0005D;</article-title>. 
<source>Zhonghua Yi Xue Yi Chuan Xue Za Zhi</source> 
<year>2012</year>;
<volume>29</volume>
(<issue>4</issue>):
<fpage>464</fpage>&#x02013;
<lpage>467</lpage>. Chinese.
</mixed-citation>
</ref>
<ref id="B24">
<label>24.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>van Rooij</surname><given-names>IA</given-names></name>
<name><surname>Vermeij-Keers</surname><given-names>C</given-names></name>
<name><surname>Kluijtmans</surname><given-names>LA</given-names></name>
<name><surname>Ocke</surname><given-names>MC</given-names></name>
<name><surname>Zielhuis</surname><given-names>GA</given-names></name>
<name><surname>Goorhuis-Brouwer</surname><given-names>SM</given-names></name><etal/>
</person-group>. 
<article-title>Does the interaction between maternal folate intake and the methylenetetrahydrofolate reductase polymorphisms affect the risk of cleft lip with or without cleft palate?</article-title> 
<source>Am J Epidemiol</source> 
<year>2003</year>;
<volume>157</volume>
(<issue>7</issue>):
<fpage>583</fpage>&#x02013;
<lpage>591</lpage>.
</mixed-citation>
</ref>
<ref id="B25">
<label>25.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wan</surname><given-names>WD</given-names></name>
<name><surname>Wang</surname><given-names>LJ</given-names></name>
<name><surname>Zhou</surname><given-names>XP</given-names></name>
<name><surname>Zhou</surname><given-names>DL</given-names></name>
<name><surname>Zhang</surname><given-names>QG</given-names></name>
<name><surname>Huang</surname><given-names>JL</given-names></name><etal/>
</person-group>. 
<article-title>&#x0005B;Relationship between nonsyndromic cleft lip with or without cleft palate (NSCL/P) and genetic polymorphisms of MTHFR C677T and A1298C&#x0005D;</article-title>. 
<source>Zhonghua Zheng Xing Wai Ke Za Zhi</source> 
<year>2006</year>;
<volume>22</volume>
(<issue>1</issue>):
<fpage>8</fpage>&#x02013;
<lpage>11</lpage>. Chinese.
</mixed-citation>
</ref>
<ref id="B26">
<label>26.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Kelly</surname><given-names>D</given-names></name>
<name><surname>O&#x00027;Dowd</surname><given-names>T</given-names></name>
<name><surname>Reulbach</surname><given-names>U</given-names></name>
</person-group>. 
<article-title>Use of folic acid supplements and risk of cleft lip and palate in infants: a population-based cohort study</article-title>. 
<source>Br J Gen Pract</source> 
<year>2012</year>;
<volume>62</volume> 
(<issue>600</issue>):
<fpage>e466</fpage>&#x02013;
<lpage>472</lpage>.
</mixed-citation>
</ref>
<ref id="B27">
<label>27.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Butali</surname><given-names>A</given-names></name>
<name><surname>Little</surname><given-names>J</given-names></name>
<name><surname>Chevrier</surname><given-names>C</given-names></name>
<name><surname>Cordier</surname><given-names>S</given-names></name>
<name><surname>Steegers-Theunissen</surname><given-names>R</given-names></name>
<name><surname>Jugessur</surname><given-names>A</given-names></name><etal/>
</person-group>. 
<article-title>Folic acid supplementation use and the MTHFR C677T polymorphism in orofacial clefts etiology: An individual participant data pooled-analysis</article-title>. 
<source>Birth Defects Res A Clin Mol Teratol</source> 
<year>2013</year>;
<volume>97</volume> 
(<issue>8</issue>):
<fpage>509</fpage>&#x02013;
<lpage>514</lpage>.
</mixed-citation>
</ref>
<ref id="B28">
<label>28.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wehby</surname><given-names>GL</given-names></name>
<name><surname>Murray</surname><given-names>JC</given-names></name>
</person-group>. 
<article-title>Folic acid and orofacial clefts: a review of the evidence</article-title>. 
<source>Oral Dis</source> 
<year>2010</year>;
<volume>16</volume>
(<issue>1</issue>):
<fpage>11</fpage>&#x02013;
<lpage>19</lpage>.
</mixed-citation>
</ref>
<ref id="B29">
<label>29.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Little</surname><given-names>J</given-names></name>
<name><surname>Gilmour</surname><given-names>M</given-names></name>
<name><surname>Mossey</surname><given-names>PA</given-names></name>
<name><surname>Fitzpatrick</surname><given-names>D</given-names></name>
<name><surname>Cardy</surname><given-names>A</given-names></name>
<name><surname>Clayton-Smith</surname><given-names>J</given-names></name><etal/>
</person-group>. 
<article-title>Folate and clefts of the lip and palate--a U.K.-based case-control study: Part II: Biochemical and genetic analysis</article-title>. 
<source>Cleft Palate Craniofac J</source> 
<year>2008</year>;
<volume>45</volume>
(<issue>4</issue>):
<fpage>428</fpage>&#x02013;
<lpage>438</lpage>.
</mixed-citation>
</ref>
<ref id="B30">
<label>30.</label>
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Munger</surname><given-names>RG</given-names></name>
<name><surname>Sauberlich</surname><given-names>HE</given-names></name>
<name><surname>Corcoran</surname><given-names>C</given-names></name>
<name><surname>Nepomuceno</surname><given-names>B</given-names></name>
<name><surname>Daack-Hirsch</surname><given-names>S</given-names></name>
<name><surname>Solon</surname><given-names>FS</given-names></name>
</person-group>. 
<article-title>Maternal vitamin B-6 and folate status and risk of oral cleft birth defects in the Philippines</article-title>. 
<source>Birth Defects Res A Clin Mol Teratol</source> 
<year>2004</year>; 
<volume>70</volume>
(<issue>7</issue>):
<fpage>464</fpage>&#x02013;
<lpage>471</lpage>.
</mixed-citation>
</ref>
</ref-list>
</back>
</article>