<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" article-type="research-article" xml:lang="en">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">AJMB</journal-id>
<journal-title>Avicenna Journal of Medical Biotechnology</journal-title>
<issn pub-type="ppub">2008-2835</issn>
<issn pub-type="epub">2008-4625</issn>
<publisher>
<publisher-name>Avicenna Research Institute</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">AJMB-6-27</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Downregulation of MMP2 and Bcl-2 in Adipose Derived Stem Cells (ASCs) following Transfection with IP-10 Gene</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Razmkhah</surname>
<given-names>Mahboobeh</given-names>
</name>
<xref ref-type="aff" rid="AF0001">1</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jaberipour</surname>
<given-names>Mansooreh</given-names>
</name>
<xref ref-type="aff" rid="AF0001">1</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ghaderi</surname>
<given-names>Abbas</given-names>
</name>
<xref ref-type="aff" rid="AF0001">1</xref>
<xref ref-type="aff" rid="AF0002">2</xref>
<xref ref-type="corresp" rid="cor1">&#x002A;</xref>
</contrib>
</contrib-group>
<aff id="AF0001">
<label>1</label>Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran</aff>
<aff id="AF0002">
<label>2</label>Department of Immunology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran</aff>
<author-notes>
<corresp id="cor1">
<label>&#x002A;</label>
<bold>Corresponding author:</bold> Abbas Ghaderi, Ph.D., Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran. <bold>Tel:</bold> +98 711 230 4952. <bold>Fax:</bold> +98 711 230 3687. <bold>E-mail:</bold> <email xlink:href="ghaderia@sums.ac.ir">ghaderia@sums.ac.ir</email>
</corresp>
</author-notes>
<pub-date pub-type="ppub">
<season>Jan-Mar</season>
<year>2014</year>
</pub-date>
<volume>6</volume>
<issue>1</issue>
<fpage>27</fpage>
<lpage>37</lpage>
<history>
<date date-type="received">
<day>21</day>
<month>09</month>
<year>2013</year>
</date>
<date date-type="accepted">
<day>16</day>
<month>11</month>
<year>2013</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2014 Avicenna Research Institute</copyright-statement>
<copyright-year>2014</copyright-year>
<license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc/3.0/">
<p>This work is licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License which allows users to read, copy, distribute and make derivative works for non-commercial purposes from the material, as long as the author of the original work is cited properly.</p>
</license>
</permissions>
<abstract>
<sec id="st1">
<title>Background</title>
<p>Mesenchymal Stem Cells (MSCs) are recently introduced as novel immunological gene carriers for treatment of cancer. It is believed that balance between the expression of angiogenic and anti-angiogenic factors, such as SDF-1 and IP-10, may regulate neovascularization within the tumor.</p>
</sec>
<sec id="st2">
<title>Methods</title>
<p>In this study, we compared the expression of important tumor promoting mediators in IP-10-transfected Adipose Derived Stem Cells (ASCs) to those transfected with SDF-1. ASCs were isolated from adipose tissue of a normal subject undergoing cosmetic mamoplasty surgery using collagenase. ASCs were transfected with IP-10 or SDF-1 propagated plasmids by electroporation method and Lipofectamin 2000. Expressions of SDF-1, CXCR4, IP-10, Bcl-2, MMP2, IL-10, IGF-1, and VEGF were detected in transfected ASCs using quantitative Real-Time Polymerase Chain Reaction (qRT-PCR).</p>
</sec>
<sec id="st3">
<title>Results</title>
<p>Results showed that the expressions of SDF-1, CXCR4, Bcl-2, MMP2, IL-10, IGF-1, and VEGF were upregulated in SDF-1-transfected ASCs. In contrast, Bcl-2 and MMP2 transcripts showed 45&#x00D7;10<sup>3</sup> and 10 fold lower expression in ASCs transfected with IP-10 compared to non-transfected cells.</p>
</sec>
<sec id="st4">
<title>Conclusion</title>
<p>Anti-angiogenic chemokines such as IP-10 may modulate tumor promoting properties of ASCs and would be introduced as novel candidates for tumor immunotherapy; however, further studies are needed to be conducted.</p>
</sec>
</abstract>
<kwd-group>
<kwd>Adipose derived stem cells</kwd>
<kwd>IP-10</kwd>
<kwd>SDF-1</kwd>
<kwd>Transfection</kwd>
<kwd>Tumor immunotherapy</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec id="S0001" sec-type="intro">
<title>Introduction</title>
<p>Due to their poor immunogenicity, MSCs are introduced as appropriate candidates for clinical applications. Since MSCs have tumor tropism, they may be used as vehicles for tumor-specific delivery of anti-tumor molecules, such as immune related genes <sup>(<xref ref-type="bibr" rid="CIT0001">1</xref>)</sup>. Application of adenoviral infected MSCs with IFN-&#x3B2; gene which could successfully inhibit the tumor growth and angiogenesis in melanoma, breast cancer, and glioma models have been reported previously <sup>(<xref ref-type="bibr" rid="CIT0001">1</xref>)</sup>. Similarly, genes of in flammatory cytokines, such as IL-2 and IL-12, are known for activating anti-tumor immune responses when they were used with MSCs as gene carrires <sup>(<xref ref-type="bibr" rid="CIT0002">2</xref>)</sup>.</p>
<p>Other candidate genes for anti-tumor immunotherapy are anti-angiogenic chemokines among which, interferon-inducible protein-10 (IP-10 or CXCL10) has recently been introduced. IP-10 is secreted by several cell types such as monocytes, endothelial cells and fibroblasts in response to IFN-&#x3B3; <sup>(<xref ref-type="bibr" rid="CIT0003">3</xref>)</sup>. This chemokine is a chemoattractant for monocytes, macrophages, T cells, NK cells and dendritic cells. Also, it has the ability to promote T cell adhesion to endothelial cells, antitumor activity, and to inhibit bone marrow colony formation and angiogenesis <sup>(<xref ref-type="bibr" rid="CIT0004">4</xref>, <xref ref-type="bibr" rid="CIT0005">5</xref>)</sup>.</p>
<p>Melanoma tumor cells transfected with IP-10 gene showed outstanding reduction in tumor growth and promotion in comparison with vector-transfected tumor cells <sup>(<xref ref-type="bibr" rid="CIT0006">6</xref>)</sup>. It has recently been described that combination of anti-angiogenic therapy with chemotherapy has much better therapeautic effects <sup>(<xref ref-type="bibr" rid="CIT0007">7</xref>)</sup>. IP-10 expressing plasmid DNA and gemcitabine injection into tumor-bearing mice led to the inhibition of tumor growth through recruiting lymphocytes, induction of tumor cell apoptosis, and longer survival time in tumor-bearing mice <sup>(<xref ref-type="bibr" rid="CIT0007">7</xref>)</sup>. Yang <italic>et al</italic> have shown that IP-10 is involved in regulating the proliferation, survival, and activation of tumor-specific T cells other than mediating anti-angiogenic effects in tumor microenvironment <sup>(<xref ref-type="bibr" rid="CIT0008">8</xref>)</sup>. Thus, <italic>in vivo</italic> targeted expression of IP-10 is considered as a potentially useful approach for immunotherapy of cancer <sup>(<xref ref-type="bibr" rid="CIT0009">9</xref>)</sup>.</p>
<p>In contrast to IP-10, SDF-1 axis contributes to angiogenesis through induction of proangiogenic factors such as IL-8 and VEGF <sup>(<xref ref-type="bibr" rid="CIT0010">10</xref>)</sup>. SDF-1 has multiple physiological functions that include homing of hematopoietic stem cells to bone marrow during fetal life and marrow transplantation <sup>(<xref ref-type="bibr" rid="CIT0011">11</xref>)</sup>, contribution to the homing of peripheral blood lymphocytes in peripheral lymphoid tissues such as lymph nodes and regulation of pre-B cell trafficking within bone marrow microenvironment as a chemoattractant factor <sup>(<xref ref-type="bibr" rid="CIT0012">12</xref>)</sup>. It has also pivotal roles in the development and function of nervous system <sup>(<xref ref-type="bibr" rid="CIT0013">13</xref>, <xref ref-type="bibr" rid="CIT0014">14</xref>)</sup>.</p>
<p>About the role of SDF-1 in cancer promotion, it has been reported that myofibroblasts derived-SDF-1 increases the growth of breast cancer cells through angiogenesis and tumor cells proliferation <sup>(<xref ref-type="bibr" rid="CIT0015">15</xref>)</sup>. Therefore, antibodies against SDF-1 receptor, CXCR4, have the ability to inhibit SDF-1-CXCR4 interaction and prevent tumor growth and angiogenesis <sup>(<xref ref-type="bibr" rid="CIT0016">16</xref>)</sup>. Fernandis AZ <italic>et al</italic> reported that stimulation of MDA-MB-231 breast carcinoma cells by SDF-1 leads to release of MMP2 and MMP9 and to increase cellular motility and migration <sup>(<xref ref-type="bibr" rid="CIT0017">17</xref>)</sup>. In contrast, the epigenetic silencing of SDF-1 increases the metastasis of breast cancer cells and its forced expression decreases the number of metastases, <italic>in vivo</italic> <sup>(<xref ref-type="bibr" rid="CIT0018">18</xref>)</sup>.</p>
<p>In addition to the application of MSCs as novel immunological gene carriers, tumor promoting activity of these cells <sup>(<xref ref-type="bibr" rid="CIT0019">19</xref>, <xref ref-type="bibr" rid="CIT0020">20</xref>)</sup> is a critical concern which can be modulated through transferring the immune related genes to these cells. For this purpose, present study aims to investigate the effects of IP-10 (as a potent anti-angiogenic factor) on the expression profile of tumor promoting molecules in adipose derived stem cells (ASCs). Results are compared to ASCs transfected with SDF-1 gene, as an angiogenic factor.</p>
<p>Among the different sources for isolating mesenchymal cells, bone marrow has been considered as the major source. However, MSCs has recently been found in other tissues such as adipose tissue <sup>(<xref ref-type="bibr" rid="CIT0021">21</xref>)</sup>. Although, MSCs isolated from both adipose tissue and bone marrow expanded easily <italic>in vitro</italic>, ASCs showed a higher proliferation rate and longer survival time in culture than bone marrow stem cells <sup>(<xref ref-type="bibr" rid="CIT0022">22</xref>)</sup>. Adipose tissues are most safe and easy to harvest with low risk and are highly abundant in the human body <sup>(<xref ref-type="bibr" rid="CIT0023">23</xref>)</sup>. Also, it is of particular interest due to the increased incidence of obesity and liposuction surgeries that are performed each year <sup>(<xref ref-type="bibr" rid="CIT0021">21</xref>)</sup>. Considering the advantages of ASCs, here we used the adipose tissue as a source for extracting MSCs.</p>
</sec>
<sec id="S0002" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="S20003">
<title>Isolation and characterization of ASCs</title>
<p>ASCs were extracted from breast adipose tissues of a healthy donor with cosmetic mammoplasty surgery after obtaining written informed consent. Fragments of the adipose tissue were washed with Phosphate Buffered Saline (PBS), minced in small pieces, and digested with 0.2% collagenase type I (GIBCO, USA) at 37<italic>&#x00B0;C</italic>. The resulted soup was centrifuged at 400 <italic>g</italic> for 10 <italic>min</italic> and then the pellet was incubated with RBC lysis buffer and centrifuged for 10 <italic>min</italic> at 300 <italic>g</italic>. Stromal Vascular Fraction (SVF) was isolated and cultured in DMEM culture medium (GIBCO) containing 10% fetal bovine serum (GIBCO) using Ficoll hypaque (Biosera) gradiant centrifugation. Non-adherent cells were discarded after 24 <italic>hr</italic> and the adherent cells were cultured by changing the medium every 4 days and harvested in passages 3-5.</p>
<p>As we showed in our previous investigations, for characterization ASCs were stained with various combinations of phycoerythrin (PE)-conjugated mouse anti-human CD44, CD105, and CD166 (all from BD Biosciences, USA) and fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD14, CD34, and CD45 (all from BD Biosciences, USA). Isotype-matched irrelevant monoclonal antibodies (BD-pharmingen, USA) were used as negative controls. Flow cytometric analysis was performed on a FACS Calibur machine (BD Biosciences, USA) using the Cell quest as data acquisition software <sup>(<xref ref-type="bibr" rid="CIT0019">19</xref>, <xref ref-type="bibr" rid="CIT0024">24</xref>, <xref ref-type="bibr" rid="CIT0025">25</xref>)</sup>.</p>
<p>To further characterize the growing cells, they were differentiated into chondrocytes and hepatocytes as described before <sup>(<xref ref-type="bibr" rid="CIT0019">19</xref>, <xref ref-type="bibr" rid="CIT0024">24</xref>, <xref ref-type="bibr" rid="CIT0025">25</xref>)</sup>.</p>
</sec>
<sec id="S20004">
<title>Preparation of competent cells, transformation, and plasmid DNA propagation</title>
<p>DH5-&#x3B1; and XL2 competent <italic>Escherichia coli (E. coli)</italic> strains were prepared for transformation based on the Hanahan method (Hanahan <italic>et al</italic>, 1983). Then, the competent cells were transformed with 1 <italic>&#x00B5;l</italic> of appropriate plasmids (OriGene, USA) using heat shock method. <italic>E. coli</italic> XL2 and DH5-&#x3B1; bacterial cells were transformed with pCMV6-XL5 (contained SDF-1 or IP-10 genes) and pEGFP -N1 (contained GFP gene) plasmids, respectively. Plasmid DNAs were extracted and propagated using appropriate S.N.A.P. Miniprep and then Midiprep kits according to the manuscripts guidlines (Invitrogene, USA). Then, the plasmid DNAs were validated with restriction enzyme digestion based on the genetic map of plasmids using <italic>Not1</italic> (Fermentas, Canada) for pCMV6-XL5 plasmid and <italic>Not1</italic> and <italic>Hind III</italic> (Fermentas, Canada) for pEGFP-N1 plasmid.</p>
</sec>
<sec id="S20005">
<title>Transfection of ASCs using electroporation method</title>
<p>One-two days prior to electroporation, ASCs were transferred to the 75 <italic>cm</italic>
<sup>2</sup> culture flasks with fresh 10% DMEM medium in order to have 50-70% confluent cells on the day of the experiment. ASCs were detached using trypsin&#x2013;EDTA (Biosera, USA), washed with PBS, gently pipetted several times using insulin syringe in order to have single cells, and counted using a hemocytometer. The cells were then washed with DMEM medium with-out serum and approximately 2&#x00D7;10<sup>6</sup> cells were transferred into an electroporation cuvette. Afterward, the cells were incubated with 400 <italic>&#x00B5;l</italic> hypo-osmolar buffer (Invitrogene USA) for 15-20 <italic>min</italic> at room temperature. About 20 <italic>&#x00B5;g</italic> plasmid DNA was added to the cells and electroporated with the square wave program with three 350 <italic>V</italic> pulses using a Bio Rad Gene Pulser. Both pulse length and pulse intervals were 10 (different electroporation setups are shown in <xref ref-type="table" rid="T0002">Supplementary Table 1</xref>). Electeroporated ASCs were then incubated on ice for 1 <italic>min</italic> and immediately transferred to the culture flask containing 10% fresh DMEM medium. First, the expression of GFP protein was assessed using flow cytometry at 24, 48, 72, and 96 <italic>hr</italic> after the electroporation. Untransfected and GFP transfected ASCs were used as the control groups. Expressions of GFP, IP-10 and SDF-1 were evaluated using either flow cytometry or qRT-PCR. Three biological repeats were conducted for each test.
</p>
<table-wrap id="T0001">
<label>Table 1</label>
<caption>
<p>The sequences of primers which were used in qRTPCR method</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="left">Gene</th>
<th align="left">Primer sequence</th>
</tr>
</thead>
<tbody>
<tr>
<td align="left">
<bold>Beta actin</bold>
</td>
<td align="left"/>
</tr>
<tr>
<td align="left"/>
<td align="left">Reverse: CACCATCACGCCCTGGTGCC<break/>Forward: ACAGAGCCTCGCCTTTGCCG</td>
</tr>
<tr>
<td align="left">
<bold>SDF-1</bold>
</td>
<td align="left"/>
</tr>
<tr>
<td align="left"/>
<td align="left">Reverse: CAGCCGGGCTACAATCTGAA<break/>Forward: TGCCAGAGCCAACGTCAAG</td>
</tr>
<tr>
<td align="left">
<bold>CXCR4</bold>
</td>
<td align="left"/>
</tr>
<tr>
<td align="left"/>
<td align="left">Reverse: TGGAGTGTGACAGCTTGGAG<break/>Forward: GGTGGTCTATGTTGGCGTCT</td>
</tr>
<tr>
<td align="left">
<bold>IP-10</bold>
</td>
<td align="left"/>
</tr>
<tr>
<td align="left"/>
<td align="left">Reverse: CAAAATTGGCTTGCAGGAAT<break/>Forward: AGGAACCTCCAGTCTCAGCA</td>
</tr>
<tr>
<td align="left">
<bold>VEGF</bold>
</td>
<td align="left"/>
</tr>
<tr>
<td align="left"/>
<td align="left">Reverse: TTTCTTGCGCTTTCGTTTTT<break/>Forward: CCCACTGAGGAGTCCAACAT</td>
</tr>
<tr>
<td align="left">
<bold>IGF-1</bold>
</td>
<td align="left"/>
</tr>
<tr>
<td align="left"/>
<td align="left">Reverse: GATGGGGGCTGATACTTCTG<break/>Forward: ATCGTGGATGAGTGCTGCTT</td>
</tr>
<tr>
<td align="left">
<bold>MMP2</bold>
</td>
<td align="left"/>
</tr>
<tr>
<td align="left"/>
<td align="left">Reverse: ATTTGTTGCCCAGGAAAGTG<break/>Forward: ATGACAGCTGCACCACTGAG</td>
</tr>
<tr>
<td align="left">
<bold>IL-10</bold>
</td>
<td align="left"/>
</tr>
<tr>
<td align="left"/>
<td align="left">Reverse: ACAGGGAAGAAATCGATGACAG<break/>Forward: AAGCTGAGAACCAAGACCCA</td>
</tr>
<tr>
<td align="left">
<bold>Bcl2</bold>
</td>
<td align="left"/>
</tr>
<tr>
<td align="left"/>
<td align="left">Reverse: GCGGAACACTTGATTCTGGT<break/>Forward: AAGATTGATGGGATCGTTGC</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="S20006">
<title>Transfection of ASCs using lipofectamin 2000</title>
<p>Another method used for transfection of ASC was lipofectamine transfection using Lipofectamine 2000 (Invitrogene, USA) based on the manufacturer&#x0027;s recommendation. For optimizing the procedure, a specific concentration of DNA should be mixed with the appropriate amount of lipofectamine 2000. The ratios of Lipofectamine to GFP plasmid DNA concentration (<italic>&#x00B5;l/&#x00B5;g</italic>) used for setting up the test were selected from the recommended amounts in the manuscript and changed to get the best result. These ratios were: 0.4/0.8, 0.8/0.8, 1.2/0.8, 1.6/0.8, 2/0.8, 2.4/0.8, 4/0.8, 4/3.2, 2/4.8, and 5/2.4. Expressions of GFP, IP-10 and SDF-1 were evaluated using either flow cytometry or qRT-PCR.</p>
</sec>
<sec id="S20007">
<title>RNA isolation, cDNA synthesis and qRT-PCR</title>
<p>Total RNA was extracted from ASCs using TRizol reagent (Invitrogen, Paisley, UK) and the phenol chloroform method. Before cDNA synthesis, the extracted RNAs were treated with DNase I (Invitrogen-Gibco, Paisley, UK) to avoid DNA contamination. Furthermore, cDNA was synthesized from 5 <italic>&#x00B5;g</italic> of total RNA using the RevertAid First Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania). Expressions of Bcl-2, VEGF, MMP2, IGF-1, IL-10, CXCR4, SDF-1, and IP-10 gene transcripts were determined 1, 2, 5, and 7 days after electroporation through the qRT-PCR method using SYBR Green PCR Master Mix kit (Applied Biosystems, Foster City, CA, USA). Each PCR reaction was carried out in duplicate in a final volume of 25 <italic>&#x00B5;l</italic> containing, 12.5 <italic>&#x00B5;l</italic> of 2x SYBR Green Master Mix, 0.2 <italic>&#x00B5;l</italic> of each 10 <italic>pmol</italic> forward and reverse primers which were designed in Primer Blast software (<xref ref-type="table" rid="T0001">Table 1</xref>), 2 <italic>&#x00B5;l</italic> cDNA and 10.1 <italic>&#x00B5;l</italic> DEPC treated water. PCR amplification was done in 40 cycles using the following program: 95<italic>&#x00B0;C</italic> for 10 <italic>min</italic>, 95<italic>&#x00B0;C</italic> for 15 <italic>s</italic>, 56<italic>&#x00B0;C</italic> for 30 <italic>s</italic>, and 60<italic>&#x00B0;C</italic> for 34 <italic>s</italic>. Finally, the data were compared to those from beta actin housekeeping gene.</p>
</sec>
<sec id="S20008">
<title>Statistical analysis</title>
<p>Expression of the molecules in transfected ASCs was reported using 2<sup>-&#x0394;&#x0394;Ct</sup> method compared to non-transfected ASCs. Besides, the average of CTs was used for 2<sup>-&#x0394;&#x0394;Ct</sup> estimation (Critical factors for Successful Real-Time PCR, <ext-link ext-link-type="uri" xlink:href="http://www.qiagen.com">www.qiagen.com</ext-link>, 2006).</p>
</sec>
</sec>
<sec id="S0009" sec-type="results">
<title>Results</title>
<sec id="S20010">
<title>Phenotyping and differentiation properties of ASCs</title>
<p>ASCs were observed as homogenous spindle-shaped cell population. Flow cytometry analysis revealed that the cultured ASCs were approximately 98% positive for the expressions of CD44, CD105, and CD166, while they had no significant expression of hemato hematopoetic specific markers; <italic>i.e</italic>., CD14, CD34, and CD45 (<xref ref-type="fig" rid="F0006">Supplementary Figure 1</xref>) <xref ref-type="bibr" rid="CIT0019">19</xref>. The hepatogenic and chondrogenic differentiations showed morphologic changes of ASCs into the polygonal/flattened and rounder/cuboidal shaped cells, respectively. Expression of several hepatogenic and chondrogenic specific genes could also reasonably verify the isolated cells as ASCs (<xref ref-type="fig" rid="F0007">Supplementary Figures 2</xref> and <xref ref-type="fig" rid="F0008">3</xref>) <sup>(<xref ref-type="bibr" rid="CIT0019">19</xref>, <xref ref-type="bibr" rid="CIT0024">24</xref>, <xref ref-type="bibr" rid="CIT0025">25</xref>)</sup>.</p>
<fig id="F0001">
<label>Figure 1</label>
<caption>
<p>A) Transfection of ASCs with GFP plasmid; B) ASCs were firstly transfected with pEGFP-N1 plasmid and the best efficiency was gained with electroporation method; C) compared to Lipofectamine 2000 (10% <italic>vs</italic> 1.3%, respectively)</p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-6-27-g001.tif" alt-version="no"/>
</fig>
<fig id="F0002">
<label>Figure 2</label>
<caption>
<p>A) mRNA expressions of IP-10; B) and SDF-1; after transfecting ASCs with plasmids DNA encoding GFP, IP-10 or SDF-1</p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-6-27-g002.tif" alt-version="no"/>
</fig>
<fig id="F0003">
<label>Figure 3</label>
<caption>
<p>2-<sup>&#x2206;&#x2206;Ct</sup> of Bcl-2, MMP2 and VEGF in ASCs, 7 days after transfecting with IP-10 plasmid and in non-transfected cells</p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-6-27-g003.tif" alt-version="no"/>
</fig>
</sec>
<sec id="S20011">
<title>GFP expression in ASCs using electeroporation or lipofectamine 2000</title>
<p>ASCs were transfected with IP-10 and SDF-1 plasmids in order to show the effects of IP-10 or SDF-1 overexpression on the expressions of tumor promoting factors. Electroporation and transfection with Lipofectamine 2000 were set up using GFP plasmid. The best result was gained by the electroporation method with 10% efficiency (<xref ref-type="fig" rid="F0001">Figure 1</xref>) after 72 <italic>hr</italic>. In addition, the best electroporation program was a square wave program with three 350 <italic>V</italic> pulses and both pulse length and pulse intervals were equal to 10 (program 13, <xref ref-type="table" rid="T0002">Supplementary Table 1</xref>).
</p>
<table-wrap id="T0002">
<label>Supplementary Table 1</label>
<caption>
<p>Different electroporation programs. The higher efficiency was gained with method 13. Electroporation was optimized by varying preset electroporation protocols, cell concentrations, and different incubation times before and after electroporation</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th align="center" colspan="10">Exponential program</th>
</tr>
<tr>
<th colspan="10">
<hr/>
</th>
</tr>
<tr>
<th align="center">No.</th>
<th align="center">&#x03BC;f</th>
<th align="center">Time</th>
<th align="center">Voltage</th>
<th align="center">Resistance</th>
<th align="center">Cuvette <italic>mm</italic></th>
<th align="center">DNA concentration</th>
<th align="center">Electroporator</th>
<th align="center">Buffer</th>
<th align="center">Efficiency (%)</th>
</tr>
</thead>
<tbody>
<tr>
<td align="center">
<bold>1</bold>
</td>
<td align="center">-----</td>
<td align="center">5 ms</td>
<td align="center">150</td>
<td align="center">----------</td>
<td align="center">2</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">Eppendorph</td>
<td align="center"><xref ref-type="table-fn" rid="TF0001">&#x002A;</xref></td>
<td align="center">2</td>
</tr>
<tr>
<td align="center">
<bold>2</bold>
</td>
<td align="center">-----</td>
<td align="center">5 ms</td>
<td align="center">300</td>
<td align="center">----------</td>
<td align="center">2</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">Eppendorph</td>
<td align="center"><xref ref-type="table-fn" rid="TF0001">&#x002A;</xref></td>
<td align="center">5</td>
</tr>
<tr>
<td align="center">
<bold>3</bold>
</td>
<td align="center">-----</td>
<td align="center">5 ms</td>
<td align="center">600</td>
<td align="center">----------</td>
<td align="center">2</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">Eppendorph</td>
<td align="center"><xref ref-type="table-fn" rid="TF0001">&#x002A;</xref></td>
<td align="center">5.5</td>
</tr>
<tr>
<td align="center">
<bold>4</bold>
</td>
<td align="center">-----</td>
<td align="center">5 ms</td>
<td align="center">150</td>
<td align="center">----------</td>
<td align="center">2</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">Eppendorph</td>
<td align="center">---------</td>
<td align="center">0.1</td>
</tr>
<tr>
<td align="center">
<bold>5</bold>
</td>
<td align="center">-----</td>
<td align="center">5 ms</td>
<td align="center">300</td>
<td align="center">----------</td>
<td align="center">2</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">Eppendorph</td>
<td align="center">---------</td>
<td align="center">0.2</td>
</tr>
<tr>
<td align="center">
<bold>6</bold>
</td>
<td align="center">-----</td>
<td align="center">5 ms</td>
<td align="center">600</td>
<td align="center">----------</td>
<td align="center">2</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">Eppendorph</td>
<td align="center">---------</td>
<td align="center">0.2</td>
</tr>
<tr>
<td align="center">
<bold>7</bold>
</td>
<td align="center">500</td>
<td align="center">----------</td>
<td align="center">350</td>
<td align="center">8</td>
<td align="center">4</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">BioRad</td>
<td align="center"><xref ref-type="table-fn" rid="TF0001">&#x002A;</xref></td>
<td align="center">6.78</td>
</tr>
<tr>
<td align="center">
<bold>8</bold>
</td>
<td align="center">1080</td>
<td align="center">----------</td>
<td align="center">350</td>
<td align="center">8</td>
<td align="center">4</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">BioRad</td>
<td align="center"><xref ref-type="table-fn" rid="TF0001">&#x002A;</xref></td>
<td align="center">0.0</td>
</tr>
<tr>
<td align="center">
<bold>9</bold>
</td>
<td align="center">50</td>
<td align="center">----------</td>
<td align="center">600</td>
<td align="center">8</td>
<td align="center">4</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">BioRad</td>
<td align="center"><xref ref-type="table-fn" rid="TF0001">&#x002A;</xref></td>
<td align="center">4.7</td>
</tr>
<tr>
<td align="center">
<bold>10</bold>
</td>
<td align="center">25</td>
<td align="center">----------</td>
<td align="center">600</td>
<td align="center">8</td>
<td align="center">4</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">BioRad</td>
<td align="center"><xref ref-type="table-fn" rid="TF0001">&#x002A;</xref></td>
<td align="center">1.53</td>
</tr>
<tr>
<td align="center">
<bold>11</bold>
</td>
<td align="center">950</td>
<td align="center">-----------</td>
<td align="center">350</td>
<td align="center">200</td>
<td align="center">4</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">BioRad</td>
<td align="center"><xref ref-type="table-fn" rid="TF0002">&#x002A;&#x002A;</xref></td>
<td align="center">2</td>
</tr>
<tr>
<td align="center">
<bold>12</bold>
</td>
<td align="center">950</td>
<td align="center">-----------</td>
<td align="center">350</td>
<td align="center">200</td>
<td align="center">4</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">BioRad</td>
<td align="center">---------</td>
<td align="center">0.5</td>
</tr>
<tr>
<td colspan="10">
<hr/>
</td>
</tr>
<tr>
<td colspan="10" align="center">
<bold>Square wave program</bold>
</td>
</tr>
<tr>
<td colspan="10">
<hr/>
</td>
</tr>
<tr>
<td align="center">
<bold>No</bold>.</td>
<td align="center">
<bold>Pulse length (S)</bold>
</td>
<td align="center">
<bold>No. of pulses</bold>
</td>
<td align="center">
<bold>Voltage</bold>
</td>
<td align="center">
<bold>Pulse interval (</bold>
<italic>
<bold>S</bold>
</italic>
<bold>)</bold>
</td>
<td align="center">
<bold>Cuvette</bold>
</td>
<td align="center">
<bold>DNA concentration</bold>
</td>
<td align="center">
<bold>Electroporator</bold>
</td>
<td align="center">
<bold>Buffer</bold>
</td>
<td align="center">
<bold>Efficiency (%)</bold>
</td>
</tr>
<tr>
<td colspan="10">
<hr/>
</td>
</tr>
<tr>
<td align="center">
<bold>13</bold>
</td>
<td align="center">10</td>
<td align="center">3</td>
<td align="center">350</td>
<td align="center">10</td>
<td align="center">4</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">BioRad</td>
<td align="center"><xref ref-type="table-fn" rid="TF0001">&#x002A;</xref></td>
<td align="center">10</td>
</tr>
<tr>
<td align="center">
<bold>14</bold>
</td>
<td align="center">10</td>
<td align="center">3</td>
<td align="center">350</td>
<td align="center">10</td>
<td align="center">4</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">BioRad</td>
<td align="center">--------</td>
<td align="center">1.2</td>
</tr>
<tr>
<td align="center">
<bold>15</bold>
</td>
<td align="center">10</td>
<td align="center">3</td>
<td align="center">350</td>
<td align="center">10</td>
<td align="center">4</td>
<td align="center">20 <italic>&#x00B5;g</italic>
</td>
<td align="center">BioRad</td>
<td align="center"><xref ref-type="table-fn" rid="TF0002">&#x002A;&#x002A;</xref></td>
<td align="center">3.4</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="TF0001">
<label>&#x002A;</label>
<p>BioRad hypoosmolar electroporation buffer.</p>
</fn>
<fn id="TF0002">
<label>&#x002A;&#x002A;</label>
<p>Electroporation buffer with the following formula: 10 <italic>mM</italic> HEPES pH = 7.4, 140 <italic>mM</italic> NaCl, 2.68 <italic>mM</italic> KCl, 1.7 <italic>mM</italic> MgCl<sub>2</sub>, 25 <italic>mM</italic> glucose pH= 7.4 in 1000 <italic>ml</italic> ddH<sub>2</sub>O</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>The best efficiency with Lipofectamin 2000 was 1.3% which was gained by the Lipofectamine to DNA concentration ratio of 4/0.8 (<italic>&#x00B5;l/&#x00B5;g</italic>).</p>
<p>As the efficiency of the electroporation method was higher than using Lipofectamin 2000, expressions of Bcl-2, VEGF, MMP2, IGF-1, IL-10, and CXCR4 were assessed in the ASCs transfected by the electroporation method.</p>
</sec>
<sec id="S20012">
<title>mRNA expressions of IP-10 and SDF-1 in IP-10, SDF-1, and GFP transfected ASCs</title>
<p>IP-10 had 6&#x00D7;10<sup>7</sup> fold more mRNA expression on day 7 in the IP-10 transfected cells compared to the non-transfected ASCs. Nonetheless, no change was observed in the expression of IP-10 in GFP transfected ASCs. SDF-1 mRNA had 14&#x00D7;10<sup>4</sup> fold more expression in the ASCs transfected with SDF-1 compared to the non-transfected ASCs on day 5. However, no obvious change in the expression of SDF-1 was observed in GFP transfected ASCs (<xref ref-type="fig" rid="F0002">Figure 2</xref>).</p>
</sec>
<sec id="S20013">
<title>Expressions of Bcl-2, MMP2 and VEGF in ASCs after transfecting with IP-10 plasmid</title>
<p>As shown in <xref ref-type="fig" rid="F0003">Figure 3</xref>, expressions of Bcl-2 and MMP2 transcripts decreased on day 7 after transfection of ASCs with IP-10. Bcl-2 and MMP2 transcripts showed 45&#x00D7;10<sup>3</sup> and 10 fold lower expression compared to the untreated cells at this day. The mRNA expression of VEGF increased after transfection with IP-10, and its expression was almost 5 times more than the control group.</p>
</sec>
<sec id="S20014">
<title>Expressions of Bcl-2, MMP2, VEGF, CXCR4, IGF-1, and IL-10 in ASCs after transfecting with SDF-1</title>
<p>mRNA expression of Bcl-2 increased to 2.5&#x00D7;10<sup>3</sup> fold more than untreated cells on day 5 after transfection of ASCs with SDF-1. Similarly, expressions of MMP2 and VEGF transcripts showed about 330 and 2&#x00D7;10<sup>3</sup> fold increase in comparison to the non-transfected ASCs, respectively (<xref ref-type="fig" rid="F0004">Figure 4</xref>).</p>
<fig id="F0004">
<label>Figure 4</label>
<caption>
<p>Bcl-2, MMP2 and VEGF mRNA expressions in ASCs 5 days after transfecting with SDF1 plasmid and in nontransfected cells. The data were shown as 2-<sup>&#x2206;&#x2206;Ct</sup>
</p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-6-27-g004.tif" alt-version="no"/>
</fig>
<p>SDF-1 caused CXCR4 mRNA augmentation to approximately 3&#x00D7;10<sup>3</sup> fold in comparison to the non-transfected ASCs. In addition, SDF-1 plasmid led to IL-10 and IGF-1 mRNA upregulation to 370 and 1&#x00D7;10<sup>5</sup> fold in ASCs on day 5 compared to the non-transfected ASCs (<xref ref-type="fig" rid="F0005">Figure 5</xref>).</p>
<fig id="F0005">
<label>Figure 5</label>
<caption>
<p>IL-10, CXCR4 and IGF-1 mRNA expressions in ASCs 5 days after transfecting with SDF1 plasmid and in nontransfected cells. The data were shown as 2-<sup>&#x2206;&#x2206;Ct</sup>
</p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-6-27-g005.tif" alt-version="no"/>
</fig>
<fig id="F0006">
<label>Supplementary Figure 1</label>
<caption>
<p>The expressions of ASCs&#x2019; specific markers were analyzed by flow cytometry and results are representative of on experiment. Filled histograms represent the specific markers (CDs) and unfilled histograms were isotype control</p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-6-27-g006.tif" alt-version="no"/>
</fig>
<fig id="F0007">
<label>Supplementary Figure 2</label>
<caption>
<p>Differentiation of ASCs to hepatocytes; A) Adipose derived stem cells were observed as spindle shaped cells in culture before differentiation; B) ASCs after differentiation to hepatocytes appeared as the polygonalflattened cells; C) Expressions of different hepatic related genes such as albumin (ALB), HNF4&#x03B1;, CYP2E1, CYP3A4, transthyretin (TTR) and (cytokeratin) KRT19 in ASCs on days 7 and 21 after treatment for hepatogenic differentiation. Data are shown as mean &#x00B1; SEM of 2-<sup>&#x2206;&#x2206;Ct</sup>
</p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-6-27-g007.tif" alt-version="no"/>
</fig>
<fig id="F0008">
<label>Supplementary Figure 3</label>
<caption>
<p>Differentiation of ASCs to chondrocytes. A) Adipose derived stem cells were observed as spindle shaped cells in culture before differentiation; B) ASCs changed morphologically through chondrogenic differentiation to the cuboidal shapes; C) Expressions of different chondrocyte related genes such as SOX9, collagen type II and aggrecan in ASCs on days 7 and 14 after treatment for chondrogenic differentiation. Data are shown as mean &#x00B1; SEM of 2-<sup>&#x2206;&#x2206;Ct</sup></p>
</caption>
<graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="AJMB-6-27-g008.tif" alt-version="no"/>
</fig>
</sec>
</sec>
<sec id="S0015" sec-type="discussion">
<title>Discussion</title>
<p>It has been evidenced that MSCs inhibit the proliferation and responses of both primary and activated T cells through Th2 type cytokine production <sup>(<xref ref-type="bibr" rid="CIT0026">26</xref>)</sup>. They also contribute to induction of tumor infiltrating T lymphocytes toward the regulatory T cells <sup>(<xref ref-type="bibr" rid="CIT0024">24</xref>, <xref ref-type="bibr" rid="CIT0027">27</xref>)</sup>. MSCs&#x2019; derived soluble factors, such as indolamine 2,3-dioxygenase (IDO), prostaglandin E2 (PGE2),Transforming Growth Factor-&#x3B2;1 (TGF&#x3B2;1), Hepatocyte Growth Factor (HGF) <sup>(<xref ref-type="bibr" rid="CIT0028">28</xref>&#x2013;<xref ref-type="bibr" rid="CIT0030">30</xref>)</sup>, Leukemia Inhibitory Factor (LIF) <sup>(<xref ref-type="bibr" rid="CIT0031">31</xref>)</sup>, and HLA-G5 <sup>(<xref ref-type="bibr" rid="CIT0032">32</xref>)</sup> are considered as known immuno-modulatory mechanisms of these cells. MSCs have the ability to transdifferentiate into Cancer Associated Fibroblasts (CAFs) and express the main molecular markers of CAFs, including SDF-1, under the influence of TGF-&#x3B2; <sup>(<xref ref-type="bibr" rid="CIT0033">33</xref>, <xref ref-type="bibr" rid="CIT0034">34</xref>)</sup>. Interestingly, MSCs are one of the main sources of TGF-&#x3B2; in the tumor microenvironment which is named as the master regulator of metastasis through EMT mechanism <sup>(<xref ref-type="bibr" rid="CIT0020">20</xref>)</sup>.</p>
<p>In contrast to the tumor promoting effects of MSCs, they are known as one of the best gene carriers for the delivery of immunological genes to the tumor microenvironment <sup>(<xref ref-type="bibr" rid="CIT0035">35</xref>)</sup> because of their ability to access the inflammatory sites after <italic>i.v</italic>. administration <sup>(<xref ref-type="bibr" rid="CIT0036">36</xref>)</sup>. Based on these reports, we hypothesized that transfection of ASCs with an angistatic gene, such as IP-10, may modulate the functional properties of ASCs and present them as better gene carriers for cancer gene therapy. Thus, we firstly aimed to increase the efficiency of our transfection methods, including electroporation and lipofectamin. The best result of transfection with IP-10 or SDF-1 plasmids was obtained by electroporation because both genes were expressed in large amounts in our transfected ASCs by this method. Then we assessed the effect of IP-10 and SDF-1 overexpression on the expression of tumor promoting cytokines. As mentioned in result section, transfection of ASCs by IP-10 led to reduced amounts of Bcl-2 and MMP2 transcripts in ASCs.</p>
<p>It has been demonstrated that IP-10 may act as similar as IL-12, regarding its antitumor effects <sup>(<xref ref-type="bibr" rid="CIT0037">37</xref>)</sup>. Luster <italic>et al</italic> genetically engineered tumor cells to secrete high levels of murine IP-10 and demonstrated that IP-10 has a strong antitumor effect <italic>in vivo</italic> that is mediated through the recruitment of lymphocytes, neutrophils, and monocytes <sup>(<xref ref-type="bibr" rid="CIT0038">38</xref>)</sup>. It has also been shown that the overexpression of MIG, IP-10, and CXCL11 in the local tumor inhibits tumor growth and metastasis through the angiostatic effect or activation of T lymphocytes or NK cells <sup>(<xref ref-type="bibr" rid="CIT0039">39</xref>)</sup>.</p>
<p>These findings and our results which showed downregulation of MMP2 and Bcl-2 in IP-10 transfected ASCs explain the importance of IP-10 in tumor immunotherapy. Additionally, combination therapy with IP-10 and other antitumor agents, such as IL-12, may have more significant tumor regressive effects compared to IP-10 or IL-12 alone <sup>(<xref ref-type="bibr" rid="CIT0037">37</xref>)</sup>. However, upregulation of VEGF after using IP-10 in ASCs is not consistent with other investigations which showed the inhibiting effects of IP-10 on the endothelial cells <sup>(<xref ref-type="bibr" rid="CIT0040">40</xref>, <xref ref-type="bibr" rid="CIT0041">41</xref>)</sup>. Thus, the present results may impose us to do further studies for better elucidation.</p>
<p>Controversial results have been obtained after transfecting different types of cells by SDF-1 gene. Evidences showed that saturation of CXCR4 through autocrine SDF-1 production reduces chemotaxis to the target organs which were rich in SDF-1 <sup>(<xref ref-type="bibr" rid="CIT0018">18</xref>)</sup>. Interestingly, adenoviral gene delivering of SDF-1 to tumors might inhibit the growth of preexisting tumors through attraction and accumulation of dendritic cells to the tumor site <sup>(<xref ref-type="bibr" rid="CIT0042">42</xref>)</sup>. SDF-1 has been introduced as an effective adjuvant to augment anti-tumor responses through recruitment of CXCR4 expressing T cells <sup>(<xref ref-type="bibr" rid="CIT0043">43</xref>)</sup>. In contrast, there are several reports showing the tumor promoting effects of SDF-1 for instance in angiogenesis of the tumor <sup>(<xref ref-type="bibr" rid="CIT0015">15</xref>, <xref ref-type="bibr" rid="CIT0016">16</xref>)</sup>. Treatment of human colon epithelial cells with SDF-1 can induce the production of IL-8 as well as GRO&#x3B1; <sup>(<xref ref-type="bibr" rid="CIT0044">44</xref>)</sup>. Stimulation with SDF-1 led to secretion of a variety of MMPs and to cellular motility <sup>(<xref ref-type="bibr" rid="CIT0017">17</xref>, <xref ref-type="bibr" rid="CIT0045">45</xref>)</sup>. Our results confirmed the tumor promoting effects of SDF-1 because CXCR4, Bcl-2, MMP2, VEGF, IL-10, and IGF-1 had more expressions after transfecting with SDF-1 gene. Thus, we conclude that the production of SDF-1 in tumor microenvironment may contribute to the tumor growth and metastasis.</p>
</sec>
<sec id="S0016" sec-type="conclusion">
<title>Conclusion</title>
<p>Overall, it is concluded that adipose tissue is a suitable source for extracting stem cells and applying them as immunological gene carriers to the tumor site. In addition, among the candidate genes IP-10 may be introduced as an anti-tumor therapeutic agent to suppress tumor progression and metastasis. However, more investigations in experimental models are required.</p>
</sec>
</body>
<back>
<ack>
<title>Acknowledgement</title>
<p>This work was financially supported by Shiraz University of Medical Sciences [Grant No. 87-4218] and Shiraz Institute for Cancer Research [ICR-100-504].</p>
</ack>
<ref-list>
<title>References</title>
<ref id="CIT0001">
<label>1</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Uccelli</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Pistoia</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Moretta</surname>
<given-names>L</given-names>
</name>
</person-group>
<article-title>Mesenchymal stem cells: a new strategy for immunosuppression?</article-title>
<source>Trends Immunol</source>
<year>2007</year>
<volume>28</volume>
<issue>5</issue>
<fpage>219</fpage>
<lpage>226</lpage>
</nlm-citation>
</ref>
<ref id="CIT0002">
<label>2</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Elzaouk</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Moelling</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Pavlovic</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Anti-tumor activity of mesenchymal stem cells producing IL-12 in a mouse melanoma model</article-title>
<source>Exp Dermatol</source>
<year>2006</year>
<volume>15</volume>
<issue>11</issue>
<fpage>865</fpage>
<lpage>874</lpage>
</nlm-citation>
</ref>
<ref id="CIT0003">
<label>3</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luster</surname>
<given-names>AD</given-names>
</name>
<name>
<surname>Unkeless</surname>
<given-names>JC</given-names>
</name>
<name>
<surname>Ravetch</surname>
<given-names>JV</given-names>
</name>
</person-group>
<article-title>Gamma-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins</article-title>
<source>Nature</source>
<year>1985</year>
<volume>315</volume>
<issue>6021</issue>
<fpage>672</fpage>
<lpage>676</lpage>
</nlm-citation>
</ref>
<ref id="CIT0004">
<label>4</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dufour</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Dziejman</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>MT</given-names>
</name>
<name>
<surname>Leung</surname>
<given-names>JH</given-names>
</name>
<name>
<surname>Lane</surname>
<given-names>TE</given-names>
</name>
<name>
<surname>Luster</surname>
<given-names>AD</given-names>
</name>
</person-group>
<article-title>IFN-gamma-inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking</article-title>
<source>J Immunol</source>
<year>2002</year>
<volume>168</volume>
<issue>7</issue>
<fpage>3195</fpage>
<lpage>3204</lpage>
</nlm-citation>
</ref>
<ref id="CIT0005">
<label>5</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Angiolillo</surname>
<given-names>AL</given-names>
</name>
<name>
<surname>Sgadari</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Taub</surname>
<given-names>DD</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Farber</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Maheshwari</surname>
<given-names>S</given-names>
</name>
<etal/>
</person-group>
<article-title>Human interferon-in-ducible protein 10 is a potent inhibitor of angiogenesis in vivo</article-title>
<source>J Exp Med</source>
<year>1995</year>
<volume>182</volume>
<issue>1</issue>
<fpage>155</fpage>
<lpage>162</lpage>
</nlm-citation>
</ref>
<ref id="CIT0006">
<label>6</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Richmond</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>The angiostatic activity of interferon-inducible protein-10/CXCL10 in human melanoma depends on binding to CXCR3 but not to glycosaminoglycan</article-title>
<source>Mol Ther</source>
<year>2004</year>
<volume>9</volume>
<issue>6</issue>
<fpage>846</fpage>
<lpage>855</lpage>
</nlm-citation>
</ref>
<ref id="CIT0007">
<label>7</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mei</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Yu</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>Y</given-names>
</name>
</person-group>
<article-title>Antitumor efficacy of combination of interferongamma-inducible protein 10 gene with gemcitabine, a study in murine model</article-title>
<source>J Exp Clin Cancer Res</source>
<year>2008</year>
<volume>27</volume>
<fpage>63</fpage>
</nlm-citation>
</ref>
<ref id="CIT0008">
<label>8</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Chu</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Xiong</surname>
<given-names>S</given-names>
</name>
</person-group>
<article-title>Targeted in vivo expression of IFN-gamma-inducible protein 10 induces specific antitumor activity</article-title>
<source>J Leukoc Biol</source>
<year>2006</year>
<volume>80</volume>
<issue>6</issue>
<fpage>1434</fpage>
<lpage>1444</lpage>
</nlm-citation>
</ref>
<ref id="CIT0009">
<label>9</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Villatoro-Hernandez</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Loera-Arias</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Gamez-Escobedo</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Franco-Molina</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Gomez-Gutierrez</surname>
<given-names>JG</given-names>
</name>
<name>
<surname>Rodriguez-Rocha</surname>
<given-names>H</given-names>
</name>
<etal/>
</person-group>
<article-title>Secretion of biologically active interferon-gamma inducible protein-10 (IP-10) by Lactococcus lactis</article-title>
<source>Microb Cell Fact</source>
<year>2008</year>
<volume>7</volume>
<fpage>22</fpage>
</nlm-citation>
</ref>
<ref id="CIT0010">
<label>10</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Shiozawa</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Jung</surname>
<given-names>Y</given-names>
</name>
<name>
<surname>Pienta</surname>
<given-names>KJ</given-names>
</name>
<etal/>
</person-group>
<article-title>The role of cxcr7/rdc1 as a chemokine receptor for cxcl12/sdf-1 in prostate cancer</article-title>
<source>J Biol Chem</source>
<year>2008</year>
<volume>283</volume>
<issue>7</issue>
<fpage>4283</fpage>
<lpage>4294</lpage>
</nlm-citation>
</ref>
<ref id="CIT0011">
<label>11</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kato</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Kitayama</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Kazama</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Nagawa</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Expression pattern of CXC chemokine receptor-4 is correlated with lymph node in human invasive ductal carcinoma</article-title>
<source>Breast Cancer Res</source>
<year>2003</year>
<volume>5</volume>
<issue>5</issue>
<fpage>R144</fpage>
<lpage>150</lpage>
</nlm-citation>
</ref>
<ref id="CIT0012">
<label>12</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sei</surname>
<given-names>S</given-names>
</name>
<name>
<surname>O&#x0027;Neill</surname>
<given-names>DP</given-names>
</name>
<name>
<surname>Stewart</surname>
<given-names>SK</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Q</given-names>
</name>
<name>
<surname>Kumagai</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Boler</surname>
<given-names>AM</given-names>
</name>
<etal/>
</person-group>
<article-title>Increased level of stromal cell-derived factor-1 mRNA in peripheral blood mononuclear cells from children with AIDS-related lymphoma</article-title>
<source>Cancer Res</source>
<year>2001</year>
<volume>61</volume>
<issue>13</issue>
<fpage>5028</fpage>
<lpage>5037</lpage>
</nlm-citation>
</ref>
<ref id="CIT0013">
<label>13</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lazarini</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Tham</surname>
<given-names>TN</given-names>
</name>
<name>
<surname>Casanova</surname>
<given-names>Ph</given-names>
</name>
<name>
<surname>Arenzana-Seisdedos</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Dubois-Dalcq</surname>
<given-names>M</given-names>
</name>
</person-group>
<article-title>Role of the &#x3B1;-chemokine stromal cell derived factor (SDF-1) in the development and mature central nervous system</article-title>
<source>Glia</source>
<year>2003</year>
<volume>42</volume>
<issue>2</issue>
<fpage>139</fpage>
<lpage>148</lpage>
</nlm-citation>
</ref>
<ref id="CIT0014">
<label>14</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ransohoff</surname>
<given-names>RM</given-names>
</name>
</person-group>
<article-title>The roles of chemokine CXCL12 in embryonic and brain tumor angiogenesis</article-title>
<source>Semin Cancer Biol</source>
<year>2009</year>
<volume>19</volume>
<issue>2</issue>
<fpage>111</fpage>
<lpage>115</lpage>
</nlm-citation>
</ref>
<ref id="CIT0015">
<label>15</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Cheng</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Hao</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J</given-names>
</name>
<etal/>
</person-group>
<article-title>CXCL12/CXCR4/CXCR7 chemokine axis and cancer progression</article-title>
<source>Cancer Metastasis Rev</source>
<year>2010</year>
<volume>29</volume>
<issue>4</issue>
<fpage>709</fpage>
<lpage>722</lpage>
</nlm-citation>
</ref>
<ref id="CIT0016">
<label>16</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Darash-Yahana</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Pikarsky</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Abramovitch</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Zeira</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Pal</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Karplus</surname>
<given-names>R</given-names>
</name>
<etal/>
</person-group>
<article-title>Role of high expression levels of CXCR4 in tumor growth, vascularization, and metastasis</article-title>
<source>FASEB J</source>
<year>2004</year>
<volume>18</volume>
<issue>11</issue>
<fpage>1240</fpage>
<lpage>1242</lpage>
</nlm-citation>
</ref>
<ref id="CIT0017">
<label>17</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fernandis</surname>
<given-names>AZ</given-names>
</name>
<name>
<surname>Prasad</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Band</surname>
<given-names>H</given-names>
</name>
<name>
<surname>Klosel</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Ganju</surname>
<given-names>RK</given-names>
</name>
</person-group>
<article-title>Regulation of CXCR4-mediated chemotaxis and chemoinvasion of breast cancer cells</article-title>
<source>Oncogene</source>
<year>2004</year>
<volume>23</volume>
<issue>1</issue>
<fpage>157</fpage>
<lpage>167</lpage>
</nlm-citation>
</ref>
<ref id="CIT0018">
<label>18</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mirisola</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Zuccarino</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Bachmeier</surname>
<given-names>BE</given-names>
</name>
<name>
<surname>Sormani</surname>
<given-names>MP</given-names>
</name>
<name>
<surname>Falter</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Nerlich</surname>
<given-names>A</given-names>
</name>
<etal/>
</person-group>
<article-title>CXCL12/SDF-1 expression by breast cancers is an independent prognostic marker of disease-free and overall survival</article-title>
<source>Eur J Cancer</source>
<year>2009</year>
<volume>45</volume>
<issue>14</issue>
<fpage>2579</fpage>
<lpage>2587</lpage>
</nlm-citation>
</ref>
<ref id="CIT0019">
<label>19</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Razmkhah</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Jaberipour</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hosseini</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Safaei</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Khalatbari</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Ghaderi</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Expression profile of IL-8 and growth factors in breast cancer cells and adipose-derived stem cells (ASCs) isolated from breast carcinoma</article-title>
<source>Cell Immunol</source>
<year>2010</year>
<volume>265</volume>
<issue>1</issue>
<fpage>80</fpage>
<lpage>85</lpage>
</nlm-citation>
</ref>
<ref id="CIT0020">
<label>20</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wendt</surname>
<given-names>MK</given-names>
</name>
<name>
<surname>Allington</surname>
<given-names>TM</given-names>
</name>
<name>
<surname>Schiemann</surname>
<given-names>WP</given-names>
</name>
</person-group>
<article-title>Mechanisms of the epithelial-mesenchymal transition by TGF-beta</article-title>
<source>Future Oncol</source>
<year>2009</year>
<volume>5</volume>
<issue>8</issue>
<fpage>1145</fpage>
<lpage>1168</lpage>
</nlm-citation>
</ref>
<ref id="CIT0021">
<label>21</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gimble</surname>
<given-names>JM</given-names>
</name>
<name>
<surname>Katz</surname>
<given-names>AJ</given-names>
</name>
<name>
<surname>Bunnell</surname>
<given-names>BA</given-names>
</name>
</person-group>
<article-title>Adipose-derived stem cells for regenerative medicine</article-title>
<source>Circ Res</source>
<year>2007</year>
<volume>100</volume>
<issue>9</issue>
<fpage>1249</fpage>
<lpage>1260</lpage>
</nlm-citation>
</ref>
<ref id="CIT0022">
<label>22</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tal&#x00E9;ns-Visconti</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Bonora</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Jover</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Mirabet</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Carbonell</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Castell</surname>
<given-names>JV</given-names>
</name>
<etal/>
</person-group>
<article-title>Hepatogenic differentiation of human mesenchymal stem cells from adipose tissue in comparison with bone marrow mesenchymal stem cells</article-title>
<source>World J Gastroenterol</source>
<year>2006</year>
<volume>12</volume>
<issue>36</issue>
<fpage>5834</fpage>
<lpage>5845</lpage>
</nlm-citation>
</ref>
<ref id="CIT0023">
<label>23</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zuk</surname>
<given-names>PA</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ashjian</surname>
<given-names>P</given-names>
</name>
<name>
<surname>De Ugarte</surname>
<given-names>DA</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>JI</given-names>
</name>
<name>
<surname>Mizuno</surname>
<given-names>H</given-names>
</name>
<etal/>
</person-group>
<article-title>Human adipose tissue is a source of multipotent stem cells</article-title>
<source>Mol Biol Cell</source>
<year>2002</year>
<volume>13</volume>
<issue>12</issue>
<fpage>4279</fpage>
<lpage>4295</lpage>
</nlm-citation>
</ref>
<ref id="CIT0024">
<label>24</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Razmkhah</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Jaberipour</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Erfani</surname>
<given-names>N</given-names>
</name>
<name>
<surname>Habibagahi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Talei</surname>
<given-names>AR</given-names>
</name>
<name>
<surname>Ghaderi</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Adipose derived stem cells (ASCs) isolated from breast cancer tissue express IL-4, IL-10 and TGF-&#x03B2;1 and upregulate expression of regulatory molecules on T cells: do they protect breast cancer cells from the immune response?</article-title>
<source>Cell Immunol</source>
<year>2011</year>
<volume>266</volume>
<issue>2</issue>
<fpage>116</fpage>
<lpage>122</lpage>
</nlm-citation>
</ref>
<ref id="CIT0025">
<label>25</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Razmkhah</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Jaberipour</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Ghaderi</surname>
<given-names>A</given-names>
</name>
</person-group>
<article-title>Bcl-2 and Fas expressions correlate with proliferative specificity of adipose-derived stem cells (ASCs) in breast cancer</article-title>
<source>Immunol Invest</source>
<year>2011</year>
<volume>40</volume>
<issue>3</issue>
<fpage>290</fpage>
<lpage>298</lpage>
</nlm-citation>
</ref>
<ref id="CIT0026">
<label>26</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Batten</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Sarathchandra</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Antoniw</surname>
<given-names>JW</given-names>
</name>
<name>
<surname>Tay</surname>
<given-names>SS</given-names>
</name>
<name>
<surname>Lowdell</surname>
<given-names>MW</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>PM</given-names>
</name>
<etal/>
</person-group>
<article-title>Human mesenchymal stem cells induce T cell anergy and downregulate T cell allo-responses via the TH2 pathway: relevance to tissue engineering human heart valves</article-title>
<source>Tissue Eng</source>
<year>2006</year>
<volume>12</volume>
<issue>8</issue>
<fpage>2263</fpage>
<lpage>2273</lpage>
</nlm-citation>
</ref>
<ref id="CIT0027">
<label>27</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghannam</surname>
<given-names>S</given-names>
</name>
<name>
<surname>P&#x00E8;ne</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Torcy-Moquet</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Jorgensen</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Yssel</surname>
<given-names>H</given-names>
</name>
</person-group>
<article-title>Mesenchymal stem cells inhibit human Th17 cell differentiation and function and induce a T regulatory cell phenotype</article-title>
<source>J Immunol</source>
<year>2010</year>
<volume>185</volume>
<issue>1</issue>
<fpage>302</fpage>
<lpage>312</lpage>
</nlm-citation>
</ref>
<ref id="CIT0028">
<label>28</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Auletta</surname>
<given-names>JJ</given-names>
</name>
<name>
<surname>Deans</surname>
<given-names>RJ</given-names>
</name>
<name>
<surname>Bartholomew</surname>
<given-names>AM</given-names>
</name>
</person-group>
<article-title>Emerging roles for multipotent, bone marrow-derived stromal cells in host defense</article-title>
<source>Blood</source>
<year>2012</year>
<volume>119</volume>
<issue>8</issue>
<fpage>1801</fpage>
<lpage>1809</lpage>
</nlm-citation>
</ref>
<ref id="CIT0029">
<label>29</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Raffaghello</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Bianchi</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Bertolotto</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Montecucco</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Busca</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Dallegri</surname>
<given-names>F</given-names>
</name>
<etal/>
</person-group>
<article-title>Human mesenchymal stem cells inhibit neutrophil apoptosis: a model for neutrophil preservation in the bone marrow niche</article-title>
<source>Stem Cells</source>
<year>2008</year>
<volume>26</volume>
<issue>1</issue>
<fpage>151</fpage>
<lpage>162</lpage>
</nlm-citation>
</ref>
<ref id="CIT0030">
<label>30</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rasmusson</surname>
<given-names>I</given-names>
</name>
<name>
<surname>Ringd&#x00E9;n</surname>
<given-names>O</given-names>
</name>
<name>
<surname>Sundberg</surname>
<given-names>B</given-names>
</name>
<name>
<surname>Le Blanc</surname>
<given-names>K</given-names>
</name>
</person-group>
<article-title>Mesenchymal stem cells inhibit the formation of cytotoxic T lymphocytes, but not activated cytotoxic T lymphocytes or natural killer cells</article-title>
<source>Transplantation</source>
<year>2003</year>
<volume>76</volume>
<issue>8</issue>
<fpage>1208</fpage>
<lpage>1213</lpage>
</nlm-citation>
</ref>
<ref id="CIT0031">
<label>31</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Najar</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Raicevic</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Boufker</surname>
<given-names>HI</given-names>
</name>
<name>
<surname>Fayyad-Kazan</surname>
<given-names>H</given-names>
</name>
<name>
<surname>De Bruyn</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Meuleman</surname>
<given-names>N</given-names>
</name>
<etal/>
</person-group>
<article-title>Adipose-tissuederived and Wharton&#x0027;s jelly-derived mesenchymal stromal cells suppress lymphocyte responses by secreting leukemia inhibitory factor</article-title>
<source>Tissue Eng Part A</source>
<year>2010</year>
<volume>16</volume>
<issue>11</issue>
<fpage>3537</fpage>
<lpage>3546</lpage>
</nlm-citation>
</ref>
<ref id="CIT0032">
<label>32</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Giuliani</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Fleury</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Vernochet</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Ketroussi</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Clay</surname>
<given-names>D</given-names>
</name>
<name>
<surname>Azzarone</surname>
<given-names>B</given-names>
</name>
<etal/>
</person-group>
<article-title>Long-lasting inhibitory effects of fetal liver mesenchymal stem cells on Tlymphocyte proliferation</article-title>
<source>PLoS One</source>
<year>2011</year>
<volume>6</volume>
<issue>5</issue>
<fpage>19988</fpage>
</nlm-citation>
</ref>
<ref id="CIT0033">
<label>33</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jotzu</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Alt</surname>
<given-names>E</given-names>
</name>
<name>
<surname>Welte</surname>
<given-names>G</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Hennessy</surname>
<given-names>BT</given-names>
</name>
<name>
<surname>Devarajan</surname>
<given-names>E</given-names>
</name>
<etal/>
</person-group>
<article-title>Adipose tissue derived stem cells differentiate into carcinoma-associated fibroblast-like cells under the influence of tumor derived factors</article-title>
<source>Cell Oncol (Dordr)</source>
<year>2011</year>
<volume>34</volume>
<issue>1</issue>
<fpage>55</fpage>
<lpage>67</lpage>
</nlm-citation>
</ref>
<ref id="CIT0034">
<label>34</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jeon</surname>
<given-names>ES</given-names>
</name>
<name>
<surname>Moon</surname>
<given-names>HJ</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>MJ</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>HY</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>YM</given-names>
</name>
<name>
<surname>Cho</surname>
<given-names>M</given-names>
</name>
<etal/>
</person-group>
<article-title>Cancer-derived lysophosphatidic acid stimulates differentiation of human mesenchymal stem cells to myofibroblast-like cells</article-title>
<source>Stem Cells</source>
<year>2008</year>
<volume>26</volume>
<issue>3</issue>
<fpage>789</fpage>
<lpage>797</lpage>
</nlm-citation>
</ref>
<ref id="CIT0035">
<label>35</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jorgensen</surname>
<given-names>C</given-names>
</name>
</person-group>
<article-title>Link between cancer stem cells and adult mesenchymal stem cells: implications for cancer therapy</article-title>
<source>Regen Med</source>
<year>2009</year>
<volume>4</volume>
<issue>2</issue>
<fpage>149</fpage>
<lpage>152</lpage>
</nlm-citation>
</ref>
<ref id="CIT0036">
<label>36</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sordi</surname>
<given-names>V</given-names>
</name>
<name>
<surname>Malosio</surname>
<given-names>ML</given-names>
</name>
<name>
<surname>Marchesi</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Mercalli</surname>
<given-names>A</given-names>
</name>
<name>
<surname>Melzi</surname>
<given-names>R</given-names>
</name>
<name>
<surname>Giordano</surname>
<given-names>T</given-names>
</name>
<etal/>
</person-group>
<article-title>Bone marrow mesenchymal stem cells express a restricted set of functionally active chemokine receptors capable of promoting migration to pancreatic islets</article-title>
<source>Blood</source>
<year>2005</year>
<volume>106</volume>
<issue>2</issue>
<fpage>419</fpage>
<lpage>427</lpage>
</nlm-citation>
</ref>
<ref id="CIT0037">
<label>37</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Palmer</surname>
<given-names>K</given-names>
</name>
<name>
<surname>Hitt</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Emtage</surname>
<given-names>PC</given-names>
</name>
<name>
<surname>Gyorffy</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Gauldie</surname>
<given-names>J</given-names>
</name>
</person-group>
<article-title>Combined CXC chemokine and interleukin-12 gene transfer enhances antitumor immunity</article-title>
<source>Gene Ther</source>
<year>2001</year>
<volume>8</volume>
<issue>4</issue>
<fpage>282</fpage>
<lpage>290</lpage>
</nlm-citation>
</ref>
<ref id="CIT0038">
<label>38</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luster</surname>
<given-names>AD</given-names>
</name>
<name>
<surname>Leder</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>IP-10, a -C-X-Cchemokine, elicits a potent thymus-dependent antitumor response in vivo</article-title>
<source>J Exp Med</source>
<year>1993</year>
<volume>178</volume>
<issue>3</issue>
<fpage>1057</fpage>
<lpage>1065</lpage>
</nlm-citation>
</ref>
<ref id="CIT0039">
<label>39</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fulton</surname>
<given-names>AM</given-names>
</name>
</person-group>
<article-title>The chemokine receptors CXCR4 and CXCR3 in cancer</article-title>
<source>Curr Oncol Rep</source>
<year>2009</year>
<volume>11</volume>
<issue>2</issue>
<fpage>125</fpage>
<lpage>131</lpage>
</nlm-citation>
</ref>
<ref id="CIT0040">
<label>40</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Luster</surname>
<given-names>AD</given-names>
</name>
<name>
<surname>Greenbergi</surname>
<given-names>SM</given-names>
</name>
<name>
<surname>Leder</surname>
<given-names>P</given-names>
</name>
</person-group>
<article-title>The IP-10 chemokine binds to a specific cell surface heparin sulfate site shared with platelet factor 4 and inhibits endothelial cell proliferation</article-title>
<source>J Exp Med</source>
<year>1995</year>
<volume>182</volume>
<issue>1</issue>
<fpage>219</fpage>
<lpage>231</lpage>
</nlm-citation>
</ref>
<ref id="CIT0041">
<label>41</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Romagnani</surname>
<given-names>P</given-names>
</name>
<name>
<surname>Beltrami</surname>
<given-names>C</given-names>
</name>
<name>
<surname>Annunziato</surname>
<given-names>F</given-names>
</name>
<name>
<surname>Lasgni</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Luconi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Galli</surname>
<given-names>G</given-names>
</name>
<etal/>
</person-group>
<article-title>Role for interactions between IP-10/Mig and CXCR3 in proliferative glomerulonephritis</article-title>
<source>J Am Soc Nephrol</source>
<year>1999</year>
<volume>10</volume>
<issue>12</issue>
<fpage>2518</fpage>
<lpage>2526</lpage>
</nlm-citation>
</ref>
<ref id="CIT0042">
<label>42</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fushimi</surname>
<given-names>T</given-names>
</name>
<name>
<surname>O&#x0027;Connor</surname>
<given-names>TP</given-names>
</name>
<name>
<surname>Crystal</surname>
<given-names>RG</given-names>
</name>
</person-group>
<article-title>Adenoviral gene transfer of stromal cell-derived factor-1 to murine tumors induces the accumulation of dendritic cells and suppresses tumor growth</article-title>
<source>Cancer Res</source>
<year>2006</year>
<volume>66</volume>
<issue>7</issue>
<fpage>3513</fpage>
<lpage>3522</lpage>
</nlm-citation>
</ref>
<ref id="CIT0043">
<label>43</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname>
<given-names>M</given-names>
</name>
<name>
<surname>Hao</surname>
<given-names>S</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>X</given-names>
</name>
<name>
<surname>Yuan</surname>
<given-names>J</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>X</given-names>
</name>
<etal/>
</person-group>
<article-title>Vaccine of engineered tumor cells secreting stromal cell-derived factor-1 induces T-cell dependent antitumor responses</article-title>
<source>Cancer Biother Radiopharm</source>
<year>2005</year>
<volume>20</volume>
<issue>4</issue>
<fpage>401</fpage>
<lpage>409</lpage>
</nlm-citation>
</ref>
<ref id="CIT0044">
<label>44</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dwinell</surname>
<given-names>MB</given-names>
</name>
<name>
<surname>Eckmann</surname>
<given-names>L</given-names>
</name>
<name>
<surname>Leopard</surname>
<given-names>JD</given-names>
</name>
<name>
<surname>Varki</surname>
<given-names>NM</given-names>
</name>
<name>
<surname>Kagnoff</surname>
<given-names>MF</given-names>
</name>
</person-group>
<article-title>Chemokine receptor expression by human intestinal epithelial cells</article-title>
<source>Gastroenterology</source>
<year>1999</year>
<volume>117</volume>
<issue>2</issue>
<fpage>359</fpage>
<lpage>367</lpage>
</nlm-citation>
</ref>
<ref id="CIT0045">
<label>45</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karnoub</surname>
<given-names>AE</given-names>
</name>
<name>
<surname>Weinberg</surname>
<given-names>RA</given-names>
</name>
</person-group>
<article-title>Chemokine networks and breast cancer metastasis</article-title>
<source>Breast Dis</source>
<year>2006-2007</year>
<volume>26</volume>
<fpage>75</fpage>
<lpage>85</lpage>
</nlm-citation>
</ref>
</ref-list>
</back>
</article>
