S. aureus COL strain (methicillin-resistant S. aureus) was kindly obtained from Dr. Mohammad Emaneini (Tehran University of Medical Science). Escherichia coli (E. coli) strains DH5α (Invitrogen, California, USA) and E. coli strains BL21 (DE3) (Novagen, Wisconsin, USA) were used for cloning and expression of recombinant protein, respectively. E. coli cells harboring recombinant plasmids were grown aerobically at 37°C in Luria-Bertani broth (Merck, Darmstadt, Germany) with or without 50 µg/ml kanamycin (Sigma, Saint Louis, MO, USA). Plasmid pET-24a (Novagen, Wisconsin, USA) was used as an expression vector in prokaryotic system.

S. aureus COL strains (methicillin-resistant S. aureus) were cultured on Luria-Bertani (LB) broth and bacteria were collected with centrifugation and then genomic DNA was extracted with mi-Bacterial Genomic DNA isolation kit (Me-tabion, South Korea) according to the manufacturer's instructions. A 242 bp (amino acids 370-451) fragment of mecA gene with trans-peptidase activity was amplified from genomic DNA as the template. Primer pair used for mecA amplification had the nucleotide sequence as follows: forward primer, containing a restriction site for HindIII (5-’ GGTAAGCTTTTATGTAT GCATGAGTAACGTAAG -3’) and reverse primer with XhoI restriction site (5’- GCCT CGAGACCATTTACCACTTCA TAT CT TG -3’). Pfu DNA polymerase (Fermentase) was used in the reaction. The PCR conditions consisted of 1 cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 40 s at 57°C, 1 min at 72°C, and a final cycle of 10 min at 72°C. The PCR products were recovered from the gel and purified by using PCR purification kit (Roche, Germany). The purified mecA fragment was digested with restriction enzymes HindIII and XhoI and ligated into the digested pET-24a vector, which provides six His residues at the C-terminus of the expressed protein. Recombinant vector pET24a-mecA was transformed into the competent E. coli DH5α cells. The integrity of the recovered plasmid was confirmed by colony PCR, restriction endonuclease digestion and sequencing ^(6–8).

For expression of recombinant protein, pET24a-mecA plasmid was transformed into competent E. coli BL21 (DE3). Transformed cells were grown at 37°C in LB medium containing kanamycin (50 µg/ ml) until exponential phase (OD₆₀₀ nm=0.6), followed by induction with 1 mM IPTG (Fermentase). Samples were collected every 3 hr for 24 hr and analyzed by SDS-PAGE to follow the best time point of protein expression. SDS-PAGE and western blot analysis were carried out to confirm protein expression ^{(1, 6–8, 26)}.

For Western blot analysis, the separated proteins by SDS-PAGE gel were transferred to a nitrocellulose membrane (Schleicher & Schuell). The membrane was then blocked in Tris-Buffered Saline (TBS) containing 5% Bovine Serum Albumin (BSA) overnight at 4°C and washed three times with TBS containing 0.05% Tween 20 (TBST).

Afterwards, the nitrocellulose membrane was incubated for 2 hr at room temperature with mouse anti-histag antibody (Qiagen, USA) diluted 1:10000 in TBS-T. Then the membrane was washed with TBS-T and then incubated with Rabbit anti-mouse immunoglobulin G (heavy and light chain) Horseradish Peroxidase (HRP) conjugate antibody (diluted 1:5000 in TBS-T) for 2 hr at room temperature. After three times of washing, the membrane was treated using DAB solution (Sigma, Saint Louis, MO, USA) and placed in darkness until the appearance of the protein band ⁽²⁶⁾.

E. coli BL21 (DE3) containing pET24a-mecA plasmid was grown in large scale and the pellets of bacterial cells expressing protein were harvested and resuspended in lysis buffer (8 M urea, 0.1 M NaH₂PO₄, and 0.01 M Tris, pH = 8.0) containing protease inhibitors. Cell suspension was sonicated and centrifuged for 20 min at 10000 rpm. After centrifugation, the recombinant protein (approximately 13 kDa) was purified from supernatant under denaturing conditions via its His-tag using Ni-nitrilotriacetic acid (Ni-NTA) affinity chromatography (Ni-NTA Agarose; Qiagen) according to the manufacture's instruction ^{(1, 7, 23, 27)}. The output fractions were analyzed by SDS-PAGE and the quantity of protein was determined with Bradford protein assay and Nanodrop analyzer. The PBP2a protein solution was dialyzed against 0.1 M phosphate buffered saline (PBS, pH = 7.4) for 72 hr to remove urea, filtered (0.22 µm, Sartorius, Germany) and then stored at -70°C until use ^{(1, 7, 21, 23)}.

Six-to-eight week old female BALB/c mice were purchased from Pasteur Institute of Iran and kept in standard condition. The mice were assigned into two groups (n = 14) and immunized subcutaneously with 20 µg of recombinant PBP2a or PBS (the control group) in complete Freund's adjuvant (Sigma, Saint Louis, MO, USA). Booster doses were also given in incomplete Freund's adjuvant with three and six week intervals. Three weeks after the last immunization, the mice were bled and serum samples were collected andstored at -20°C until use ^{(1, 6–8, 21, 23)}.

The enzyme-linked immunosorbent assay (ELISA) was used to determine the presence of anti-PBP2a antibodies in the sera of immunized mice. Ninety-six well microtiter plates (Extragene, USA) were coated with 100 µl of 10 µ/ml of recombinant protein (1 µg/well) diluted in PBS, and incubated overnight at 4°C. Each plate was washed three times with PBS–T and blocked with PBS containing 5% BSA (blocking buffer) for 2 hr at 37°C. Following blocking and washing, mouse sera were diluted in blocking buffer (1:200 to 1/402240). The plates were incubated for 2 hr at 37°C. Then, the plates were washed three times and incubated with HRP-conjugated anti-mouse IgG (Sigma, USA) diluted 1:7000 (as secondary antibody) at 37°C for 2 hr. To develop the reaction, plates were washed and incubated with TMB (tetramethylbenzidine) as the substrate for 15 min at room temperature in dark condition. The reaction was stopped with 100 µl of 2N H₂SO₄, and the results were read at optical density of 450 nm (OD₄₅₀) by ELISA reader ^{(1, 6–8)}.

Data were summarized using descriptive statistical methods. Student's independent t-test (Statview) and one-way analysis of variance (ANOVA) were used to compare the mean values. A p-value less than 0.05 represented a significant difference. All data were analyzed using SPSS Software Version 20.0 ^{(1, 6–8)}.

Specific primers were designed to amplify mecA from the S. aureus COL strain. The expected size of mecA PCR product, approximately 242 bp, is shown in Figure 1. The integrity of the recombinant vector pET24a-mecA was confirmed by double digestion using HindIII and XhoI restriction enzymes (Figure 2) and colony-PCR with specific primers. Identity and orientation of mecA in the construct were confirmed by sequencing the recombinant vector. Cloned mecA gene sequence showed 99.9% homology with ref-erence sequences.

Cells harboring pET24a-mecA plasmid were cultured at 37°C in the presence of IPTG. The whole-cell lysates were analyzed by 12% SDS-PAGE. One major band appeared approximately at the 13 kDa position in the case of IPTG induction, which was the expected position of PBP2a (Figure 3). Induction of the cells at 37°C for 6 hr and IPTG with dosage of 1.0 mmol/L was found to be optimal to achieve the highest-level of PBP2a expression. Both supernatant and the pellet of cell lysates were tested for the presence of recombinant proteins. The majority of the expressed protein was detected in inclusion bodies. Therefore, recombinant protein was carefully purified with Ni-NTA affinity chromatography under denaturing condition (Figure 3). This purification yielded 100 mg of highly purified recombinant PBP2a protein from one of induced culture.

Western blot analysis was performed to detect the expression of desired protein. The major band observed in SDS-PAGE (13 kDa) (Figure 4) was confirmed as PBP2a protein by western blot analysis with mouse serum anti-his-tag, which indicates the apparent molecular mass of 13 kDa.

The specific antibody production was measured by an optimized ELISA method with sera obtained before (pre-immune serum) and after each immunization course with recombinant vaccine. All animals immunized with recombinant vaccine (mecA) were able to produce specific antibodies anti-mecA and the highest antibody titers were observed after the third immunization (second booster). The vaccinated group (Group I) produced higher anti-PBP2a specific antibody after each course of immunization as compared with the control group (after first immunization p = 0.023, after second immunization p = 0.017, after third immunization p = 0.0001) (Figure 5). Result of titration in the experimental group after the third immunization showed that immunization with mecA significantly increased total antibody at the dilution of 1/200 to 1/25600 as compared with the control group (p < 0.03) (Figure 6).