The yeast and bacterial strains used in the present study are listed in Table 1. pGEM–T Easy cloning system (Promega) was used for the cloning of PCR products. Plasmid pYES2 (Invitrogen) containing Saccharomyces cerevisiae (S. cerevisiae) URA3 gene was used as a control in transformation experiments.

Yeasts strains were grown and kept in YPD medium (1% yeast extract, 2% polypeptone and 2% dextrose). Yeast Nitrogen Base with ammonium sulphate and without amino acids (YNB medium; Sigma-Aldrich) was prepared at a concentration of 0.67% and was supplemented with 2% glucose, 10 mM uridine and uracil, and 0.1% 5-FOA (Sigma) to use in screening of auxotrophs.

Genomic DNA from both S. cerevisiae Σ1278b and S. boulardii was prepared as described before (12). All PCRs were performed as 30 cycles of 95°C for 1 min, 58°C for 30 s and 72°C for 1 min. The S. cerevisiae actin fragment (500 bp) was amplified using primers ACT1_F (CCCAATTGAACACGGTATTG) and ACT1_R (GCAGCGGTTTGCATTTCTTG) as a control in PCR reactions (Table 2).

A single colony from S. boulardii parental strain was grown for 20 hr in YPD broth. Cells were collected and washed with PBS and subjected to UV mutagenesis. 20 ml of cell suspension (1×10⁷ viable yeasts ml ⁻¹ in PBS) was gently agitated by a magnetic flea in a glass petri dish (with the lid removed) 15 cm below a UV lamp (Philips, TUV 15W/ G15). A dose response experiment was carried out by removing 0.5 ml samples at 10 s intervals over a 100 s period. Irradiated cell suspensions were stored in foil-wrapped tubes at 4°C overnight to avoid photoreactivation. Dilutions of cell suspension from various exposure times were made and plated onto YPD agar (3 replicates per dilution). All plates were incubated in the dark at 30°C. Colonies were counted initially after two days and finally after four days of incubation. A kill curve was plotted to estimate the exposure time to UV light to kill 90% of cells. This was then used for the subsequent mutagenesis procedures and the UV irradiated cells were kept at 4°C in a foil-wrapped tube.

To isolate ura3 auxotroph mutants, approximately 10⁷ mutagenized cells were spread onto 5-FOA plates containing uracil and uridine, and then were incubated at 30°C up to one week. The recovered colonies were isolated and plated on YNB medium with or without uracil supplement. Uracil auxotroph mutants were detected by their ability to grow only in the presence of this chemical.

The S. cerevisiae URA3 sequence (URA3/YEL021W, yeast genome database) was used as a template to design the URA3 specific primers. The forward primer, URA3_F (5′-G TTAATGTGGCTGTGGTT TC-3′), and the reverse primer, URA3_R (5′-GTTACTTGG TTC TGGCGAGG-3′) (Table 2), were designed to amplify an approximately 1.2 kb URA3 fragment containing the entire coding sequence with 5‘ and 3‘ flanking regions.

PCR on genomic DNA of S. boulardii was carried out using these primers. The resulting PCR fragment was cloned into pGEM-Teasy vector. The final vector was called pGEM-ura3 and used in transformation of the auxotroph strains.

S. boulardii auxotrophic yeasts (ura3^-) were transformed with the plasmid pGEM-ura3 using a standard electroporation method (13). As a positive control, a commercial episomal vector, pYES2 (Invitrogen), was used in transformation experiments. Following the transformation, cells were plated on YNB agar medium lacking uracil and uridine supplements.

Resistance tests were performed as described by van der Aa Kühle (14). In brief, all strains were refreshed in MYGP medium (Malt extract 1%, Yeast extract 1%, Peptone 2%, Dextrose 2%) for 24 hr at 30°C. Assays were performed in a 200 µl volume in 96-microwell plates. The wells were inoculated in triplicates with 10⁶ yeast cells and the cells were allowed to grow for 48 hr at 30°C in YNB medium containing acid (pH = 2.5) or 0.3% (w/v) Oxgall (Difco). For the auxotroph mutants the medium was supplemented with uracil (10 mM). Viability tests were performed after 4 hr of incubation by plating of 100 µl of cell suspensions onto MYGP agar for 3 days at 30°C.

UV irradiation of cell suspension from S. boulardii was performed and the percentage of survival against time was plotted to estimate the UV exposure time required to kill 90% of cells (Figure 1). An exposure time of 23 s was chosen for mutagenesis.

Mutagenized yeasts were screened for ura3 ^- phenotype on 5-FOA/UU plates. Approximately 350 FOA resistant colonies were isolated and further screened for uracil auxotrophy (Figure 2). Eight colonies out of 350 were able to grow in YNB-uracil medium but not in YNB. Three mutants, S. boulardii M1, M2 and M3, which had similar growth properties compared to the wild type, were chosen for further studies. These mutants were tested for mutation reversion by plating of 10⁶, 10⁷ and 10⁸ viable cells on YNB agar and counting the number of possible revertants up to 5 days. No revertant was appeared during these incubation periods, indicating that a stable mutation has occurred in the target gene.

The URA3 gene from S. boulardii was successfully amplified as a 1.2 kb fragment using designed specific primers (Figure 3). This was subsequently cloned into pGEM-Teasy vector. The final construct, pGEM-ura3, was confirmed by restriction analysis and sequencing. The size of URA3 construct was 4.3 kb and the digestion map using SacI/NcoI showed two expected fragments as ∼1 kb and 3.3 kb (Figure 4B).

The potential ura3 ^- mutants of S. boulardii (M1, M2 and M3) were transformed with pGEM-ura3 vector. As a positive control, the same mutants were transformed with an episomal vector, pYES2, containing URA3 as a selectable marker (Figure 5A). Both transformations were efficient and resulted in several hundred transformants from each single reaction (1 µg of each plasmid per reaction).

To confirm that the pYES2 construct is present in these ura3+transformants, plasmid DNA was extracted from one of these transformants and subjected to restriction analysis using EcoRI and ClaI Enzymes. The results confirmed that the isolated plasmid is intact and identical to original plasmid, pYES2 (Figure 5B).

The ability of auxotroph mutants to resist pH = 2.5 and 0.3% oxgall was assessed. Table 3 shows the growth phenotype of three different mutants compared to the wild types. All tested strains showed different resistance against acid and bile. Among the mutants, only S. boulardii M2 showed a resistance pattern similar to the S. boulardii wild type.